வலம் செப்டம்பர் 2017 இதழ் – முழுமையான படைப்புக்கள்


வலம் செப்டம்பர் 2017 இதழ் படைப்புகளை இங்கே வாசிக்கலாம்.

வந்தே மாதரம் – தமிழாக்கம்: ஜடாயு

வந்தே மாதரம்: தேசத்தின் உணர்வு – பி.ஆர்.ஹரன்

ஆங்கிலவழிக் கல்வியின் அபாயங்கள் – லஷ்மணப் பெருமாள்

ஜி.எஸ்.டி: கட்டுக்கதைகளும் உண்மையும் – ஜெயராமன் ரகுநாதன்

டெஸ்ட் டியூப்பில் இண்டர்நெட் – சுஜாதா தேசிகன்

சில பாதைகள் சில பதிவுகள் -1 (பாதாளக் கரண்டியில் பராசகதி) – சுப்பு

அவர்கள் அப்படித்தான் – ஹரன் பிரசன்னா

திரை: தர்மத்தின் குரல் – ஆமருவி தேவநாதன்

கிடைமட்டக் கற்றல் – ஹாலாஸ்யன்

கடன் (சிறுகதை) – ரெங்கசுப்ரமணி

ஹெச்.ஜி.ரசூல் (அஞ்சலி) – ஜடாயு


ஹெச்.ஜி.ரசூல்: அஞ்சலி – ஜடாயு


கவிஞரும் எழுத்தாளருமான தக்கலை ஹெச்.ஜி.ரசூல்  ஆகஸ்டு 5, 2017 அன்று  தனது 59ம் வயதில் மாரடைப்பால் மரணமடைந்தார். 

வஹாபிய அடிப்படைவாதமும், மூர்க்கமான இஸ்லாமிய மதவெறியும் வளர்ந்து வரும் தமிழ்ச்சூழலில் நம்பிக்கையும் நேசமும் தரும் ஒரு குரலாக இருந்தவர் ஹெச்.ஜி.ரசூல். சிற்றிதழ்கள் மட்டுமின்றி, 2002ம் ஆண்டு முதலே இணையத்திலும் தொடர்ந்து ஜிகாதி பயங்கரவாதத்திற்கு எதிராக எழுதியும் விவாதித்தும் வந்தவர் அவர். அவரது சில கருத்துக்களுடன் இணைய இந்துத்துவ எழுத்தாளர்களுக்கு மாறுபாடு இருந்தது. அவற்றை விமர்சித்தும் எழுதியிருக்கிறார்கள்.  ஆயினும் அடிப்படையில் அவர்மீது உள்ள உயர்மதிப்பும் மரியாதையும் என்றும் குறைந்ததில்லை. 

சூஃபி ஆன்மீகம் பற்றிய ஒரு ஆழமான புரிதல் அவரிடம் இருந்தது. “பீர்முகமது அப்பாவின் பாடல்கள் புரியவேண்டுமானால் குரான் மட்டும் போதாது, திருக்குறள், சைவ வைணவ பக்தி இலக்கியம், அத்வைதம், சாங்கியம், யோகம், பௌத்தம், சமணம் போன்ற இந்திய தத்துவ மரபுகள் இவற்றை உள்ளடக்கிய பல்சமயச் சூழல் பற்றிய புரிதல் தேவை” என்று  ‘அப்பாவின் ஞானப்புகழ்ச்சி’ பற்றிய ஒரு கட்டுரையில் குறிப்பிட்டிருந்தார். 

ஜிகாதி பயங்கரவாதத்திற்கு எதிரான பிரகடனமாக அவர் எழுதிய கீழ்க்காணும் கவிதையில், 

லாத்தும் உஜ்ஜாவும் மனாத்தும்
உடைபட்டு கீழேவிழுந்து புலம்பின குரல்
திரும்பவும் கேட்கிறது. 

என்ற வரி  நம்மை  உலுக்கக் கூடியது. இஸ்லாமின் உருவாக்கத்தின்போதே அழித்தொழிக்கப் பட்ட அரேபியாவின் பண்டைக் கலாசாரத்து பெண் தெய்வங்களின் குரலைக் கேட்ட தமிழ் முஸ்லிம் கவி அனேகமாக ரசூல் ஒருவராகவே இருக்கக் கூடும். சாக்தம் மற்றும் தாய் தெய்வ வழிபாடு குறித்து இஸ்லாமிய மதநம்பிக்கைகளுக்கு முற்றிலும் முரணான பரிவான கண்ணோட்டம் அவருக்கு இருந்தது. 

ஹெச்.ஜி.ரசூல்  மறைவிற்கு நமது கண்ணீர் அஞ்சலி. ஓம் சாந்தி.  

வேறெந்த சொற்களும் அவனிடம் மிச்சமில்லை (2011) 

ஒரு சொர்க்கத்தை சம்பாதிப்பதற்காக
நரகங்களை உருவாக்குபவன்
என்வீதிவழியே வந்து
என்னைத் தட்டி எழுப்பிச் சென்றான்.
கறுப்புவடுவோடு கண்டுணர்ந்த பேரழகு
கீற்றாய்ச் சிறுகோடாய் தேய்ந்து
இரவின் கதையை எழுத
பிறையின் ஒளியை முத்தமிட்டு
அதிசயித்துப் பார்க்கும் கண்கள்
மின்னல் வாகனத்தில் பறந்து சென்றது.
தொடமுடியாத ஏழுவானங்களும் அதிர
அவன் கூக்குரலிட்டான்.
நிரம்பிய கண்ணீரில்
ஒளுவெடுத்துப் புனிதப்படும் உள்ளங்கைகளும்
நெடுவெளி மணற்காட்டில்
தய்யம் செய்யும் விரல்களும்
அறிந்திராதொரு வன்மத்தின் தீண்டலில்
அவனின் அபயக்குரல் தொடர்ந்தது.
லாத்தும் உஜ்ஜாவும் மனாத்தும்
உடைபட்டு கீழேவிழுந்து புலம்பின குரல்
திரும்பவும் கேட்கிறது.
மூசாவையும் ஈசாவையும் குறித்து
அறிவித்த தீர்ப்பால்
சிலுவையிலிருந்தும் போர்வாள்கள் முளைத்து
அவனின் குரல்வளையை நெருங்கிவந்தன.
யுத்த இருளின் புகைமூட்டத்தில்
எதிரே கண்டால் வெட்டச் சொன்ன புனித வசீகரம்
எதிரியின் கைகளிலும் துப்பாக்கிகளைத் திணித்தன.
போதையூட்டப்பட்ட சொற்கள்
எப்போதும் பைஅத்திற்கு தயார்
பைசாகோபுரங்களைத் தகர்த்தும் எறியலாம்
அதன் அடுத்தடுத்த பக்கங்களில்
தினந்தோறும் கவனிப்பாரற்று
துயரம் மேலிட கண்ணீர் சிந்திக் கிடக்கிறது
லக்கும் தீனுக்கும் வலியதீன்.
குண்டுகள் வெகுஅருகாமையிலும் வெடிக்கின்றன.
மறைக்கப்பட்ட வரிகளினூடே
அர்ஷின்முத்திரை ஒன்று தவறிப்போனதை
எல்லோராலும் அறிந்துகொள்ள முடியவில்லை
சொல்லி முடிப்பதற்குள்
லாத்தும் உஜ்ஜாவும் மனாத்தும்
ரத்தத்திலிருந்து முளைக்கத் தொடங்கின.
ஜிகாதின் சொற்களைத்தவிர அவனிடம் இப்போது
வேறெந்தச் சொற்களும் மிச்சமிருக்கவில்லை. 

*******

கடன் [சிறுகதை] – ரெங்கசுப்ரமணி




ஜோகனஸ்பர்க்கில் விமானம் தரையைத் தொட்டது.

“ஹூம், ஆன்சைட் ஆஃபர், ஆஸ்திரேலியா, அமெரிக்கான்னு அனுப்புவானுங்கன்னு பாத்தா, ஆப்பிரிக்காவுக்கு அனுப்பி வச்சிருக்கானுங்க” என்று மனதுக்குள் புலம்பிக்கொண்டே விமானத்தைவிட்டு வெளியே வந்தான் மணி. சின்ன பெயர். ஆனால் ஆள் பனைமரத்தில் பாதி இருப்பான். முழுப்பெயர் மணிகண்டப் பிரபு. நனைந்த பனை நிறத்தில் இருப்பான். விமானத்தில் அவன் அருகில் அமர்ந்திருந்த இஸ்கான் ஆசாமி அவனைப் பார்த்துக் கையசைத்துவிட்டு வெளியே சென்றார். மணியின் கையில் அவர் தந்த பகவத்கீதையின் ஆங்கில மொழிபெயர்ப்பு. மணி தன் பெட்டியைப் பொறுக்கிக்கொண்டு வெளியே வந்தான்.

அவன் வேலை செய்வது ஒரு குட்டி தகவல் தொழில்நுட்ப நிறுவனம். வேலைக்குச் சேர்ந்த அடுத்த மாதமே இங்கே அனுப்பி வைத்துவிட்டார்கள். முதல் பயணமே ஆப்பிரிக்காவிற்கு. முடியாது என்று மறுத்தவனை ஒரு மாதம்தான், நல்ல ஊர், சிங்கம் எல்லாம் ரோட்டில் திரிந்து கொண்டிருப்பதைப் பார்க்கலாம் என்று வேப்பிலையடித்து அனுப்பி வைத்துவிட்டனர்.

வெளியில் ஜோமி காத்திருந்தான். சென்றவாரமே அவன் அங்கு வந்துவிட்டான். மணிக்கு வீசா பிரச்சினையால் தாமதமாகிவிட்டது. ஜோமி பெட்டியை வாங்கிக்கொண்டு “வா போகலாம்” என்று பார்க்கிங்க் ஏரியா நோக்கி நடந்தான். விமான அசெளகரியங்களைப் பற்றிப் பேசிக்கொண்டே காரை அடைந்தனர். ட்ரைவர் நன்றாகப் பழுத்த ஆப்பிள் போல இருந்தான். மணியின் கையை இழுத்துக் குலுக்கி, “வெல்கம் டு செளத் ஆஃப்பிரிக்கா” என்றான்.

இருபது நிமிடப்பயணம். ராண்ட்பர்க். ஒரு குட்டி நகரம். ஒரு மரங்கள் சூழ்ந்த வீதியில் ஒரு வீட்டின்முன் நின்றது. ஜோமியிடம் இருந்த சாவியின் ரிமோட்டின் மூலம் கேட்டைத் திறந்து உள்ளே சென்றார்கள். வீட்டின் சுற்றுச்சுவர் முழுவதும் மின்சார வேலி. யாரும் உள்ளே நுழைந்துவிட முடியாது. ஆறடி உயர வெள்ளைக்கார பெண்மணி ஒருத்தி வந்தாள். கிறிஸ்டா. அறிமுகப்படலம் முடிந்து உள்ளே சென்றார்கள்.

“நீ ரெஸ்ட் எடு, நான் போய்ட்டு வர்றேன். நாளைக்கு நீ வந்தா போதும்” என்று கூறிவிட்டு ஜோமி வெளியேறினான்.

அறையைச் சுற்றிப் பார்த்தான். நல்ல பெரிய அறை. படுக்கைக்கு எதிரில் ஒரு பெரிய சிலுவை. பெரிதென்றால், மணியை அதில் வைத்து அறையலாம், அந்தளவிற்குப் பெரியது. அருகில் ஒரு குட்டி மண் பானை. சுடச்சுட வெந்நீரில் குளித்துவிட்டு ஆடை மாற்றிக்கொண்டு படுத்தான். சிலுவையை நோக்கிக் கால் நீட்ட மனம் கொஞ்சம் சங்கடப்பட்டது. தலையை மாற்றி வைத்தால், சிலுவையில் யாரோ தொங்கிக்கொண்டு உதைப்பது போலப் பீதியாக இருந்தது. காலை நேராக நீட்டாமல் மடக்கி வைத்துப் படுத்து உறங்கினான்.

மாலையில் ஜோமியுடன் பேசிக்கொண்டிருந்துவிட்டு, அவனது அறையிலிருந்த அடுப்பில் நூடுல்ஸை வேகவைத்துத் தின்று முடித்தான்.

ஏசி இல்லையென்றாலும் ஒன்றும் தெரியவில்லை. என்ன ஊருடா ஒரு கொசுகூட இல்லை என்று நினைத்துக் கொண்டிருந்தான்.

அடுத்த நாள், காலை அலுவலக கார் வந்தது. நெரிசல் ஏதுமில்லா சாலைகள். மலைப்பகுதி போன்று ஏற்றஇறக்கமான சாலைகளில் சென்று அலுவலகத்தை அடைந்தனர். ‘என்னடா ஒரு பைக்கக் கூட காணோம்’ என்று நினைத்த மாத்திரத்தில் ஒரு பைக், கண்ணிமைக்கும் நேரத்தில் காரைக் கடந்து பறந்து போனது.

 அலுவலகம். இரண்டாவது மாடி. “ஹாய் நான் பெஞ்சமின்” என்று ஒருவன் மணிக்குக் கை கொடுத்தான். பெஞ்சமின் அந்த நிறுவனத்தின் இயக்குநர். மணியைவிடக் கொஞ்சம் உயரமும், நிறமும் அதிகம். “சே… வீரபத்ர சாமி சிலை மாதிரியில்லா இருக்கான்” என்று நினைத்துக்கொண்டான். பெஞ்சமின் அவன் குழுவிலிருந்த மற்றவர்களை அறிமுகம் செய்து வைத்தான். சிட்னி, மொஹாபூ என்று இரண்டு கருப்பர்கள். ப்ராவோ என்று ஒரு வெள்ளைக்காரன்.

அலுவலகத்தில் அதிகம் கருப்பர்கள்தான். “என்னடா எல்லாம் நம்ம கலருல்ல இருக்கானுங்க.”

“இத ஆரம்பிச்சவன் வெள்ளைக்காரன்தான். பெஞ்சமின் வந்தபின்னாடி, எல்லாம் அவன் ஆளுங்கள போட்டு நிரப்பிட்டான், ஏகப்பட்ட உள்நாட்டுக் கலவரம் உண்டு. நாம எதுலயும் தல நீட்டாம வந்த வேலைய பாத்துட்டு போயிடனும்” என்றான் ஜோமி.

“நம்ம ஊரு மாதிரிதானா?”

சிறிது நேரத்தில் சிட்னி வந்து வேலையை விளக்கினான். அந்த நிறுவனம் அங்கிருக்கும் பல சுரங்க நிறுவனங்களுக்கான மென்பொருட்களைச் செய்து தந்து கொண்டிருக்கின்றது. சுரங்கங்களில் ஏற்படும் சின்ன சின்ன விபத்துகள், நிகழ்ச்சிகள் அனைத்தும் பதிவு செய்யப்பட வேண்டும். எப்போது அதிகம் விபத்து நடக்கின்றது, அதற்குக் காரணம், அது நடக்காமல் தடுக்க வேண்டியது என்ன என்பதை அந்த மென்பொருளின் உதவியோடு கணிக்கலாம். தடுப்பு நடவடிக்கைகளைக் கண்காணிக்கவும் உபயோகப்படும். இதில்தான் மணியும் வேலை செய்யவேண்டும்.

மணிக்கு ஒரே நாளில் வேலை போரடித்துவிட்டது. விதவிதமான படிவங்களை தயார் செய்வது மட்டுமே அவன் வேலை. சில பல கோப்புகளை பிரதியெடுத்து, அதில் பெயர்களை மாற்றினால் போதும். மணி ஒரு எக்ஸல் ஷீட்டை தயார் செய்தான். அதில் விபரங்களை நிரப்பினால் போதும். மிச்ச வேலை வெறும் காப்பி பேஸ்ட்தான்.

சிட்னிக்கும், மொஹாபூவிற்கும் ஆச்சரியம். மணி பத்து முறை விளக்கியும் அவர்களால் அதைப் புரிந்துகொள்ள முடியவில்லை. ப்ராவோ பார்த்துவிட்டு தோளைக் குலுக்கிக் கொண்டு போய்விட்டான். அவனுக்கும் புரியவில்லை.

“என்னடா, சுத்த மாக்கானுகளா இருக்கானுங்க, எப்படி இவனுகள வேலைக்கு எடுத்தானுங்க?”

“எல்லாம் பெஞ்சமின் வேலைதான். சிட்னிக்கு மட்டும் கொஞ்ச நஞ்சம் தெரியும், மத்தவங்க எல்லாம் சும்மாதான்.”

மணியும், ஜோமியும் அதன்பின் ஒரு நாளைக்கு அரை மணி நேரம் மட்டுமே வேலை செய்ய வேண்டியிருந்தது. அதன்பின் வெட்டி வேலைதான்.

வெட்டியாக இருக்கும்போது ப்ராவோ வந்து இவர்களுடன் பேசிக்கொண்டிருப்பான். அவனது மூதாதையர்கள் பிரிட்டீஷ்க்காரர்கள். இங்கு வந்து பல தலைமுறைகள் ஓடிவிட்டன. முதலாம் உலகப்போர் காலத்தில் வந்தவர்கள், அப்படியே அங்கு தங்கிவிட்டார்களாம்.

பல கதைகள் சொன்னான். நெல்சன் மண்டேலா பற்றி, கருப்பர்களின் வளர்ச்சி பற்றி.

மணி ஊருக்குக் கிளம்பும் நாள் வந்தது. கிளம்புவதற்கு முதல்நாள் அனைவரும் வெளியே சென்றார்கள். ஒரு கலைப்பொருள் கடையில் கல்லில் செய்யப்பட்ட பொம்மை மட்டும் போதும் என்று எடுத்துக் கொண்டான்.

“200 ராண்ட்.”

மணி கணக்குப் போட்டான், இந்தியமதிப்பில் சுமார் 1,200 ரூபாய். இதற்கா?

“100 ராண்ட்?”

“இல்லை இல்லை, அது எனக்கு நஷ்டத்தைத் தரும்.”

“நான் உங்கள் விருந்தினன் அல்லவா, தரலாம்.”

“சரி, நீ என் சகோதரன். உனக்காக 150 ராண்ட். நீ சகோதரன் என்பதால் மட்டுமே தருகின்றேன். இவன் கேட்டால் தரமாட்டேன்” என்று ப்ராவோவைச் சுட்டினான்.

ப்ராவோ முகம் சுண்டிவிட்டது.

மணிக்கு அதற்கு மேல் பேரம் பேச விருப்பமில்லை. வாங்கிக்கொண்டு வந்தான்.

அடுத்தநாள் உள்ளூர் விடுமுறை, ஹெரிட்டேஜ் டே என்றனர். அனைவரும் சிட்னியின் இடத்திற்குச் சென்றனர்

“மணி, உனது மகிழ்ச்சிக்காக” என்று கோப்பையை உயர்த்தினர்.

மணி, தன் கோப்பையிலிருந்த வொயினை உயர்த்தி, “நன்றி நண்பர்களே” என்றான்.

ப்ராவோதான் ஆரம்பித்தான், “நேற்று அந்தக் கடைக்காரன் உன்னை நன்றாக ஏமாற்றி விட்டான், ஐம்பது ராண்ட்கள் கூட வராது.”

“எனக்கும் தெரியும், அதற்கு மேல் என்னால் என்ன செய்ய முடியும். நான் வெளியூர் ஆசாமி, உள்ளூர்க்காரர்கள் நீங்கள்தான் பேசியிருக்க வேண்டும்.”

“சிட்னியோ, மொஹாபூவோ பேசியிருக்கலாம். ஆனால் கடைக்காரன் கருப்பன். அதனால் அவர்கள் தலையிடவில்லை. நான் பேசினால் கேட்கமாட்டான்.”

“நான் ஏன் பேசவேண்டும், சகோதரன் சம்பாதிப்பதை நான் ஏன் கெடுக்க வேண்டும்? இப்போதுதான் எங்கள் நிலை கொஞ்சம் கொஞ்சமாக மாறிவருகின்றது” என்றான் சிட்னி.

“ஆமாம் இங்கு எல்லாம் மாறிக் கொண்டு வருகின்றது. நாங்கள் எல்லாம் தேவையற்றவர்களாகின்றோம்” என்றான் ப்ராவோ.

“ஆமாம், மாறத்தான் மாறும். இத்தனை வருடம் நாங்கள் அடங்கியிருந்தோம், இப்போது மேலே வருவது உங்களுக்கு பொறுக்கவில்லை” என்றான் சிட்னி.

“நீங்கள் மேலே வருவதில் எனக்கு என்ன பிரச்சினை. திறமையிருந்தால் மேலே வரவேண்டியதுதான். அதுதான் இல்லையே” என்றான் ப்ராவோ.

ஜோமி, “ப்ராவோ போதும், உனக்கு அதிகமாகிவிட்டது போல. அமைதியாக இரு.”

“நான் சரியாகத்தான் இருக்கின்றேன். என்னால் வண்டி கூட ஓட்ட முடியும். அலுவலகம் முழுவதும் உங்கள் ஆட்கள்தான். திறமையுள்ளவன், இல்லாதவன் என்று பார்க்காமல் நிரப்புகின்றான் பெஞ்சமின்.”

“ஆமாம், இத்தனை நாள் மறுக்கப்பட்ட இடத்தில் இப்போது உரிமையுடன் அமர்கின்றோம், என்ன தவறு” என்றான் சிட்னி.

“சரிதானே ப்ராவோ, அவர்களுக்கு மறுக்கப்பட்ட அநீதிக்கு இதுதான் பரிகாரமாக இருக்க முடியும்” என்றான் மணி.

“நீ அவர்களின் சகோதரன், அப்படித்தான் பேசுவாய்.”

“அப்படி ஏதுமில்லை, உங்கள் உள்ளூர் அரசியலில் எனக்கு என்ன ஆர்வம் இருக்க முடியும்?”

“பிறகு ஏன் இதைப்பற்றி பேசுகின்றாய், உனக்கு என்ன தெரியும் இதைப் பற்றி?”

“ஆனால் உனக்கு சொல்வதற்கு என்னிடம் ஒன்று உண்டு.” தனது கைப்பேசியில் இருந்த புகைப்படத்தைக் காட்டினான். “இது எங்கள் வீடு, என் தாத்தா கட்டியது, அவருக்கு பின் என் அப்பாவிற்கு வந்தது. பல வருடங்கள் கழித்து ஒருநாள் உள்ளூர் வங்கியிலிருந்து ஒரு நோட்டீஸ் வந்தது. வாங்கிய கடனை உடனே செலுத்து என்று. என் அப்பாவிற்கு ஒரே ஆச்சரியம், நான் கடனே வாங்கவில்லையே என்று. வங்கியில் விசாரித்தபின் தெரிந்தது, அவரது தந்தை அந்த வீட்டை வைத்துக் கடன் வாங்கியிருப்பது. என் அப்பா என்ன செய்திருக்க வேண்டும் என்று நினைக்கின்றாய்?”

“கடனை கட்ட வேண்டியதுதான்.”

“சரி, அவரும் கட்டினார். ஆக அவர் வாங்காத கடனை அவர் அடைக்க வேண்டியிருந்தது. நான் கூட சிறிது பணம் அனுப்பினேன், ஆனால் நான் ஏன் யாரோ வாங்கிய கடனுக்கு பணம் கட்ட வேண்டும்?”

“வீடு உனக்குத் தானே வரும், வீட்டை அனுபவிக்கும் உனக்கு அதன் கடனை மட்டும் எப்படி மறுக்க முடியும்” என்றான் ப்ராவோ.

“அது போலத்தான் இதுவும் உன் தந்தை உனக்கு வைத்துவிட்டுப் போன கடன். உன் மூதாதையர்கள் விட்டுப் போன கடன். நீ இப்போது அதை செலுத்திக் கொண்டு இருக்கின்றாய், நாம் கடன் பட்டிருக்கின்றோம்” என்றான் மணி.

“மிகச்சரி, இந்தியர்கள் தர்க்க ரீதியாக பேசுவதில் சிறந்தவர்கள். எங்களால் கூட இவ்வளவு சரியாக எடுத்து வைக்க முடியுமோ என்னவோ” என்றான் சிட்னி.

“சரி, நீ சொல்வது சரிதான். கடனை நான் அடைக்க வேண்டியதுதான். ஆனால் கடனுக்காக நிலத்தை மொத்தமும் விட்டுவிட்டுச் செல்ல முடியுமா. இங்கேயே பிறந்து வளர்ந்த என்னை, நீ வெளிநாட்டவன் என்றால் எங்கு செல்வது? நான் இம்மண்ணைச் சேர்ந்தவன் இல்லை என்றாகுமா?” என்றான் ப்ராவோ.

“இது உங்கள் ப்ரிட்டிஷார் இந்தியாவில் பயன்படுத்திய பொய் ஆயுதத்தின் மறு முனை, இங்கு உண்மையாக மாறி இப்போது உன்னை குத்துகின்றது” என்றான் மணி.

“நாங்கள் இங்கு படும் அவஸ்தை உனக்கு புரியாது.”

“ஏன் எனக்குப் புரியாது, எனக்கு மிக நன்றாகவே புரியும்” என்றான் மணி.

ப்ராவோ புரியாமல் தலையை அசைத்துவிட்டு இன்னுமொரு பாட்டிலைக் கவிழ்த்துக் கொண்டு மட்டையானான்.

அடுத்த நாள்.

விமான நிலையத்திற்குக் கிளம்பினார்கள். கிறிஸ்டா ஒரு பைபிள் புத்தகத்தை மணிக்குப் பரிசளித்தாள். மணி தன் பையில் வைத்திருந்த, இஸ்கான்க்காரர் இவனுக்குத் தந்த பகவத்கீதையை அவளுக்கு அளித்தான். அவள் முகம் போனதைப் பார்த்து மனதிற்குள் சிரித்துக்கொண்டு கிளம்பினான்.

“அது என்ன புத்தகம்” என்றான் சிட்னி.

“அது எங்கள் மதப்புத்தகம்” என்றான் மணி.

“ஹே, அதுதான் சரி. இவர்களை இப்படித்தான் திருத்த வேண்டும்” என்றான் சிட்னி.

“சரி நான் விடை பெறுகிறேன்” என்று கூறிவிட்டு ப்ராவோ கிளம்பினான். “மீண்டும் சந்திக்கலாம்” என்று மகிழ்வுடன் கூறிவிட்டு ப்ராவோ மணியைக் கட்டி அணைத்துக்கொண்டான்.

“என்ன இது. கயிறு? இதுவும் உங்கள் மத விஷயமா, உன் நெற்றியில் இருப்பது போல” என்றான் ப்ராவோ

“இல்லை, இது என்னிடம் இருக்கும் உன் வெள்ளைத்தோல்” என்றான் மணி.

******** 

கிடைமட்டக் கற்றல் – ஹாலாஸ்யன்




நான் புதிதாகச் சேர்ந்திருக்கிற நிறுவனத்தில் என்னோடு சேர்ந்தவர்கள் எட்டு பேர். நாங்கள் எட்டுபேருமே ஒரே வேலைக்காகத்தான் எடுக்கப்பட்டிருந்தோம். ஓர் இணையவழிப் பாடத்தை வடிவமைக்கும் Project lifecycle என்கிற படிநிலைகள் சுமார் 20 தேறும். நாங்கள் எட்டுபேரும் மூன்று அனுபவமுள்ள ஆட்களுக்குக்கீழ் சேர்க்கப்பட்டோம். அவர்கள் தருகிற வேலைகளை முடிக்க வேண்டியதுதான் எங்களுக்கு ஆரம்பத்தில் தரப்பட்ட வேலை. அதற்குப் பின்னரே எங்களுக்கே எங்களுக்கென்று ஒரு தனி பாடம் பிரித்துத் தரப்படும்.

எங்களுக்கு‌ மேலிருந்த அனுபவமிக்க மூன்று பேரும் வேறு வேறு பாடங்களில் வேறுவேறு project lifecycle நிலைகளில்‌ இருந்ததால், நாங்கள் எட்டு பேரும் வேறுவேறு நிலைகளில் பழகினோம். மொத்தமாகப் பார்த்தால் இருபது நிலைகளில் ஒவ்வொன்றுக்கும் எங்கள் எட்டு பேரில் இரண்டு பேராவது பழகியிருந்தார்கள். நாங்கள் யாராவது புதிதாக ஒரு நிலைக்கு அறிமுகமாகையில் உடனிருப்பவர்களிடம் இருந்து அந்த நிலையின் சவால்களைக் கேட்டறியவும் அதற்கான தீர்வுகளைக் கண்டறியவும் முடிந்தது‌.

எங்களைப் பயிற்றுவிப்பவர்கள், எங்களின் மேலாளர்கள் ஆகியோர்களிடம் இருந்து எங்களால் நிச்சயமாக இவ்வளவு விஷயங்களைக் கற்றிருக்க முடியாது. மேலும் நாங்கள் எட்டு பேருக்கு பதில்‌ இருவர் மட்டும் இருந்திருந்தாலும் இவ்வளவு கற்றல் சாத்தியமில்லை.

காரணம் கற்றலானது மேலிருந்து கீழ் பயணிக்கையில் ஒரு ஈகோ இருக்கிறது. ஆசிரியர்களெல்லாம் அப்படி இல்லை என்று மல்லுக்கு வராதீர்கள். விதிவிலக்குகளை உதாரணங்களாகக் காண்பித்து நியாயப்படுத்தமுடியாதே. அப்படி ஈகோ உடைய நிறைய ஆசிரியர்களை எனக்குத் தெரியும். மேலும் அலுவலகச் சூழ்நிலையில் மேலாளர்களின், பயிற்றுநர்களின் நேரமும் முக்கியம். இப்படிப்பட்டக் கிடைமட்டக் கற்றல் ஒரு அலுவலகச் சூழலில் நேரம், உழைப்பு என்று இரட்டைச் சேமிப்பைச் சாத்தியமாக்கும். பெரும்பான்மையான கற்றல்கள் நாங்கள் ஒன்றாய் அமர்ந்து தேநீர் அருந்துகையில், மதியம் உணவருந்துகையில் நடைபெற்றது. மேலும்‌ பரஸ்பரம் உதவிக் கொள்ளுதலையும், மேலிடத்தில் கேட்கத் தயங்குகிற சில சந்தேகங்களை, நம்முடன் வேலைக்குச் சேர்ந்து நம்மோடே பணியாற்றும் நபரிடம் தயக்கமின்றிக் கேட்டுக்கொள்ள முடியும்.

இதை அலுவலகங்கள் மட்டுமல்ல இயற்கையும் செய்கிறது என்றால் என்ன சொல்வீர்கள்?

பரிணாம வளர்ச்சி என்பது ஒரு கற்றல்தான். மாறுகிற சூழ்நிலை, இருப்பிடம், உணவுமுறை, உயிர்பிழைப்பு என்று ஒவ்வொன்றுக்கும் ஏற்றவாறு உடற்செயற்பாட்டை, உடலின் அமைப்பை, சில விசேஷமான உறுப்புகளை, உணர்வுகளைப் பெற்று வேறு தனி ஜீவராசியாக நிற்கின்றதுதான் அதன் செயல்முறை. ஆனால் இந்த மாற்றம் மரபணுக்கள் தன்னிச்சையாக மாற்றம் பெற்று, சந்ததியில் வழிவழியாக வருவதற்கு ஏகப்பட்ட காலம் பிடிக்கும். சில சமயம் ஆயிரக்கணக்கான வருடங்கள் கூட ஆகலாம். ஆனால் சில மரபணுக்களை சக ஜீவராசிகளிடம் இருந்து பெற்றுக்கொள்ள ஒரு வழி இருக்கிறது.

உடனே வல்லூறுகளின் இறகுகள் வளரும் ஜீன்களைச் செலுத்திக்கொண்டு பறந்து, நாளையில் இருந்து பெட்ரோல் செலவையெல்லாம் குறைத்துவிட முடியாது. நம்மைப்போல பலசெல் உயிரிகளின் இது சிக்கலான விஷயம். காரணம் நம் ஒவ்வொரு உறுப்புகளின் செல்களும் தனித்தன்மை கொண்டவை. மூளை, சிறுநீரகம், கணையம் என்று ஒவ்வொன்றின் அமைப்பும் செயல்பாடும் வேறுவேறு.

ஆனால் பேச்சுலர் ரூம்கள்‌ மாதிரி சகலமும் ஒரே இடத்தில் நடக்கிற ஒற்றைச்செல் உயிரிகளில் இது மிக எளிதாக நடந்துவிடும்.
இது பாக்டீரியாக்களில்தான் நடந்திருக்கிறது. அவைகள்தான் இங்கு முதன்முதலில் மரபணுக்களை மாற்றிக்கொண்டு கற்றுக்கொண்டவை. இந்தக் கற்றல் ஒரு சுமப்பான் carrier மூலமாகவோ அல்லது நேரடி மரபுப்பொருள் பகிர்வு மூலமாகவோ நடைபெறலாம். எங்கோ எப்படியோ பச்சைத் தண்ணீர் செல்லில் படாமல் (எவ்வளவு நாளைக்குதான் பச்சைத் தண்ணீர் பல்லில் படாமல்) உயிர்வாழக் கற்றுக்கொண்ட ஒரு பாக்டீரியா, அதை பிற பாக்டீரியாக்களுக்கு மூன்று விதமாய்க் கடத்தலாம்.

முத்து திரைப்படத்தில் “இரவு எட்டு மணிக்கு தோட்டத்துக்கு வரவும். தீபாவளி பரிசு காத்திருக்கிறது” என்று எழுதிய சீட்டு எல்லோர் மேலும் விழுந்து, மொத்த வீடும் தோட்டத்தில் திரியுமல்லவா? அதுபோல, அந்த நீரின்றி வாழத் தேவையான மரபணுவை மட்டும் பிரதியெடுத்து, வெளியே தூக்கிப்போட அதை இன்னொரு பாக்டீரியா பிடித்து உள்ளிழுத்து அதை தன்னோடு இணைத்துக்கொள்ளும். இதன் பெயர் ட்ரான்ஸ்ஃபர்மேஷன் (transformation).

அல்லது “முப்பது நாள் நீரின்றி வாழும் வித்தை! பயிற்றுவிப்பவர் சகாராவுக்குச் சென்று வந்த சித்த பாக்டீரியா” என்பதுபோல் அந்த மரபணு இல்லாத பாக்டீரியாவுக்கு, மரபணு உள்ள பாக்டீரியா, செல்களுக்கு நடுவே ஒரு இணைப்புப் பாலம் ஏற்படுத்தி அதன்மூலம்‌ கடத்தலாம். அதன்பெயர் காஞ்சுகேஷன் (conjugation).

மூன்றாவது வகை, அந்த மரபணுவை ஒரு சுமப்பான் (carrier) இன்னொரு சாதாரண மரபணுவுக்குத் தந்து அதையும் நீரின்றி வாழத் தயார்ப்படுத்துவது. இதில் ஒரு சுமப்பான் (கடத்தி) வருகிறதல்லவா? அந்தச் சுமப்பான்தான் இந்தக் கதையின் திருப்புமுனையே. அந்த சுமப்பான்களாகச் செயல்பட்டது ஒரு வைரஸ். சுமப்பான் மூலம்‌ கடத்துவதற்குப் பெயர் ட்ரான்ஸ்டக்‌ஷன் (transduction).

வைரஸ் என்றவுடனேயே நமக்கெல்லாம், உலகின் ஆபத்துகள் எல்லாமே அமெரிக்காவில் மட்டுமே நடப்பதாய்க் காட்டும் ஹாலிவுட் படங்களில் ஒரு ஒளிரும் பச்சை நிற வஸ்துவில் இருக்கும் ஜந்து, அதனால் பாதிக்கப்பட்டவர்கள் வாய் மூக்கு கண் வழியாய் இரத்தம் வழியக் கோரமாய் இறந்து கிடக்கிற காட்சிதான் நினைவுக்கு வரும். அது ஓரளவு உண்மைதான். சாதாரண சளி ஜூரம் முதல், ஆட்கொல்லியாய் இருந்து ஒழிக்கப்பட்ட பெரியம்மை (சின்னம்மை இப்போதைக்கு ஒழியாது போலிருக்கிறது. இது அரசியல் அல்ல) போன்ற ஆட்கொல்லி நோய்கள், திடீர் திடீரென்று வரும் பன்றிக்காய்ச்சல், பறவைக்காய்ச்சல், எபோலா, சிறுகச்சிறுகக் கொல்லும் எய்ட்ஸ் வரை, ஆண்டுதோறும் வைரஸ் தாக்கும் நோய்களால் இறப்பவர்கள் எக்கச்சக்கம். ஆனால் அவை மட்டும் வைரஸ்கள் அல்ல. விலங்கினங்கள் மட்டுமின்றி, தாவரங்களைத் தாக்குகிற வகை உண்டு. பூவன் வாழைத்தார் மாதிரி இருக்கிற டொபோக்கோ மொஸைக் வைரஸ் (Tobacco Mosaic Virus) என்று தாவரங்களை மட்டும் சவட்டிக் களைகிற வைரஸ்கள் உண்டு. அதில் பார்த்தோமானால் பாக்டீரியாக்களை மட்டும் தாக்கும் வைரஸ்கள் உண்டு. அவற்றிற்கு பாக்டீரியோஃபேஜ் (bacteriophage) என்று பெயர். Phage என்னும் லத்தீனச் சொல்லுக்கு உண்ணுதல் என்று பொருள். அதாவது பாக்டீரியாவைத் தின்னும் வைரஸ். பார்க்க ஏதோ எதிர்கால ரோபோட் மாதிரி குச்சிக் கால்கள் உருளையான உடல்பாகம் என்று இருக்கும். பார்க்கச் அழகாக இருக்கிறதே என்று நினைத்தால் செயல்கள் இன்னும் ஆச்சர்யம்.

பாக்டீரியாவின் மேல்போய் அமர்ந்து அதன் மேல் ஓட்டினைத் துளைத்து, தன் மரபணுவை உள்ளே அனுப்பும், உள்ளே போய் பாக்டீரியாவின் இயக்கங்களை நிறுத்திவிடும். பின்னர் அந்த பாக்டீரியாவின் செல் இயக்கத்தை முழுக்க முழுக்க அந்த வைரஸ் தன் கட்டுப்பாட்டுக்குக் கொண்டு வந்துவிடும். பாக்டீரியாவின் மரபுப் பொருளான டி.என்.ஏ வை பிரதியெடுக்கும், புரதங்களைத் தயாரிக்கும் எல்லாவற்றையும் வைரஸ் தன்னுடைய மரபுப் பொருளை பிரதியெடுக்கவும், அதன் வெளிப்புற புரத அடுக்குகளைத் தயாரிக்கவும் பயன்படுத்தும்.

இங்கு இரண்டு சாத்தியக்கூறுகள் இருக்கின்றன. முதல் வகையில், அந்த வைரஸ் மளமளவென பல்கிப் பெருகி அவையெல்லாம் ஒன்றாய்ச் சேர்ந்து பாக்டீரியாவை உள்ளிருந்து கிழித்துக்கொண்டு வெளிவரும். பெரிய அளவில் பார்த்தால் ரொம்பக் கொடூரமாக இருக்கும் போல. ஆனால் எலெக்ட்ரான் நுண்ணோக்கி மூலம் பார்க்க இந்தச் செயல்பாடு அழகாய் பஞ்சு வெடித்துப் பறப்பது போல இருக்கும். இப்படி நடப்பதை லைட்டிக் சுழற்சி lytic cycle என்கிறார்கள். இது கூலிப்படை மாதிரி. உள்ளே புகு, அடி, சிதை, மீண்டும் உள்ளே புகு அடி இப்படித் தாக்கிக்கொண்டே போய்க்கொண்டிருக்கும்.

இரண்டாவது வகைதான் ஸ்லீப்பர் செல்கள். உள்ளே புகுந்த வைரஸின் மரபுப் பொருள் பாந்தமாய் பாக்டீரியாவின் மரபுப் பொருளோடு ஒட்டிக் கொண்டுவிடும். பின்னர் ஒரு ஸ்லீப்பர் செல்போல் அந்த வைரஸ் அந்த பாக்டீரியாவுக்குள்ளேயே வளர ஆரம்பிக்கும்.ஆனால் பாக்டீரியாவும் இறந்து போகாது. நினைவில் வையுங்கள். பாக்டீரியாவே நுண்ணோக்கிகளில் ஒரு மாதிரி குன்ஸாகத்தான் தெரியும். ஆனால் அதற்குள்ளே நூற்றுக்கணக்கில் உயிர்கள் என்று நினைக்கையில் இயற்கை என்னும் அதிசயத்தை நாம் வியந்தே ஆக வேண்டும். இப்படி உள்ளேயே வளர்கையில் உள்ளே அணிவகுக்கும் புது வைரஸ்களுக்குள் கொஞ்சம் பாக்டீரியாவின் மரபுப் பொருளும் இருக்கும். திடீரென்று ஒரு நாள் சூழல் கூடி வருகையில் பழையபடி இங்கும் லைய்டிக் சுழற்சி ஆரம்பித்து விடும். இம்மாதிரி பாக்டீரியாவுக்குள் காத்திருந்து, அதன் மரபுப் பொருளோடு வைரஸ் உருவாவதற்கு லைஸோஜெனிக் சுழற்சி என்று பெயர். இப்போது அந்த பாக்டீரியாவைக் கிழித்து வெளிவந்திருக்கும் வைரஸிற்குள் கொஞ்சம் பாக்டீரியாவின் மரபுப் பொருளும் இருக்குமல்லவா? அது நேரே இன்னொரு பாக்டீரியாவைப் போய்த் தாக்கும்.

இங்குதான் கதையின் உச்சகட்டக் காட்சி, சில தற்செயல்களில் அந்த வைரஸ் பாக்டீரியாவிடம் இருந்து ஒரு குறிப்பிட்ட மரபணுவை (நம் கதைப்படி தண்ணியில்லாக் காட்டில் பிழைத்திருத்தல்) மட்டும் மொத்தமாய் அள்ளிக்கொள்ளவும் சாத்தியம் உண்டு. இப்படி ஒரு குறிப்பிட்ட மரபணுவோடு போகும் வைரஸ் இன்னொரு சாதாரண பாக்டீரியாவைத் தாக்கும். இங்கு அந்த பாக்டீரியாவுக்குள் செலுத்தப்படும் வைரஸின் மரபணு சில சிக்கலாக உயிரியல் நடைமுறைகள் வாயிலாக பாக்டீரியாவின் மரபுப் பொருளோடு போய் இணைந்துவிடலாம். இப்போது அந்த மரபணு அந்த பாக்டீரியாவுக்கும், அதன் சந்ததிகள் எல்லாவற்றிற்கும் கிடைத்துவிடும். இப்படித்தான் இந்த கிடைமட்ட மரபணுப் பரிமாற்றம் வேலை செய்கிறது. சிக்கலான பகுதியைத் தாண்டிவிட்டோம். இனி இதன் விளைவுகளைப் பற்றிப் பார்ப்போம்.

இப்படி ஒரு வெவ்வேறு வகை பாக்டீரியாக்களுக்குள் பகிரப்பட்ட மரபணுக்கள்,பரிணாம வளர்ச்சியில் ஒரு முக்கியப் பங்காற்றின என்பதை உயிரியல் ஆராய்ச்சியாளர்கள் எவ்வித சந்தேகமுமின்றி ஏற்றுக்கொள்கிறார்கள். இதன்மூலம் நமக்கு நன்மையும் நிகழ்ந்திருக்கிறது. சோதனைகளும் வந்திருக்கிறது.

சோதனைகளை முதலில் பார்த்துவிடுவோம். மனிதனைத் தாக்க முடியாத ஒரு பாக்டீரியாவிற்கு,மனித உடலில் நோயை உண்டாக்கக் கூடிய மரபணு இப்படிப்பட்ட லைஸோஜெனிக் சுழற்சியால் கிடைக்கலாம். டிப்தீரியா நோயை உண்டாக்கும் ஒரு குறிப்பிட்ட வகை பாக்டீரியா மனிதனைத் தாக்கும் திறனில்லாத பாக்டீரிய வகைக்குக் கொடுத்துவிட்டது. இன்னொரு சாத்தியக் கூறு ஒரு குறிப்பிட்ட மருந்திற்கு எதிர்ப்புத் திறன் பெற்றுவிட்ட பாக்டீரியா பிற பாக்டீரியாக்களுக்கு அந்த நோயெதிர்ப்பு மரபணுவைக் கடத்திவிடலாம். இது இப்போது ஆங்கில மருத்துவத்திற்குப் பெரிய சிக்கலாக வந்து நிற்கிறது.

பாக்டீரியாக்கள் சம்பந்தப்படாத வைரஸ்களால் உண்டாகிற சளி ஜூரம் போன்றவற்றிற்கெல்லாம் ஆன்டிபயாட்டிக்குகள் கொடுத்து கொடுத்து, பாக்டீரியாக்களை ஆன்டிபயாட்டிக்குகளால் ஒன்றும் செய்ய முடியாத படிக்கு ஆக்கியிருக்கிறோம். இந்த ஆன்டிபயாட்டிக்குகளுக்கு எதிர்ப்புத்திறன் பெற்றுவிட்ட பாக்டீரியாக்களுக்கு முன்னர் நாம் நிராயுதபாணிதான். அதிலும் வான்கோமைசின், மெத்திசில்லின் என்று இரு ஆன்டிபயாட்டிக்குகளை, எல்லாவற்றிற்கும் கேக்கும் என்று ப்ரிஸ்க்ரிப்ஷனில் எழுதித் தள்ளியிருக்கிறோம். ஸ்டாஃப் staph என்று செல்லமாக அழைக்கப்படும் ஸ்டாஃபிலோகாக்கஸ் ஆரியஸ் Staphylococcus aureus என்னும் பாக்டீரியா இந்த இரு ஆன்டிபயாட்டிக்குகளுக்கு ஏற்கனவே எதிர்ப்புத்திறன் பெற்றாகி விட்டது. மிர்ஸா, விர்ஸா MRSA(Methicillin resistant Staphylococcus aureus), VRSA(Vancomycin Resistant Staphylococcus aureus) என்று இரு வகைகள் உருவாகி உலவிக்கொண்டிருக்கின்றன. “அய்யய்யோ! பாதுகாப்புக்கு ஆஸ்பத்திரிக்குப் போய் வைத்தியம் பாக்கலாம்” என்றால்,பொறுங்கள்!! அவை அதிகம் புழங்குவதே அங்குதான்.

ஆனால் இந்த கிடைமட்ட மரபணுக் கடத்தல் மூலம் கிடைத்த நன்மைகளும் அளப்பரியவை. முக்கியமாக நீரிழிவு நோயாளிகள், தினப்படி இன்ஸுலின் கிடைப்பதற்காக ஈ. கோலி E. coli என்னும் ஒரு பாக்டீரியாவுக்கு நன்றி சொல்லியாக வேண்டும். இன்ஸுலின் ஒரு புரதம். அதைச் சுரக்கும் மரபணுவைப் பிரித்து, அதை பாக்டீரியோஃபேஜுக்குள் செலுத்தி, அதனை ஈ.கோலி பாக்டீரியாவை எடுத்துக்கொள்ள வைத்து பின்னர் அந்த பாக்டீரியா சுரப்பதைச் சுத்திகரித்துத் தயாரிக்கிறார்கள். மரபணு மாற்றம் என்பது இதுதான்‌‌.

பசில்லஸ் துரங்கனிஸிஸ் Bacillus thurenginesis என்னும் பாக்டீரியாவின் சில தாவர உண்ணிப் பூச்சிகளை விரட்டும் திறனைக் கண்டறிந்து, அதற்குக் காரணமான மரபணுவை, வைரஸ் மூலம் நேரடியாகத் தாவரங்களுக்குத் தருவது மரபணு மாற்றம் செய்யப்பட்ட தாவரங்களை உருவாக்கும். பி.டி BT என்பது அந்த பாக்டீரியாவின் பெயர்ச் சுருக்கம்தான்.

இதைத்தவிர அதிகம் பேசப்படாத ஒரு உபயோகம் இருக்கிறது‌. ஆன்டிபயாட்டிக்களுக்கெதிராக பாக்டீரியாக்கள் அணிவகுத்தாயிற்று என்று பார்த்தோம் அல்லவா? அதற்கு அந்த பாக்டீரியோஃபேஜ்களே மாற்று. ஆன்டிபயாட்டிக் என்னும் வேதி மூலக்கூறுகளைப் புரிந்துகொண்டு பாக்டீரியாக்கள் எதிர்ப்புத் திறனை உருவாக்கிக்கொள்ளலாம். ஆனால் ஒரு பாக்டீரியோஃபேஜ் வைரஸ் என்பது ஒரு உயிர். பாக்டீரியா, அந்த வைரஸ் தாக்குதலுக்கு ஏதேனும் எதிர்ப்புத் திறன் வளர்த்துக் கொண்டால், இந்த வைரஸ் உடனே தன்னை மாற்றிக் கொள்ளும். எப்படியாவது பாக்டீரியாவைத் தாக்க வழி கண்டுபிடிக்கும்.

அப்படி ஒவ்வொரு பாக்டீரியாவுக்கும் ஒரு பாக்டீரியோஃபேஜ் வைரஸைக் கண்டுகொண்டால், கிருமித் தொற்றுகளை மனித உடலுக்கு எந்த அச்சுறுத்தலும் இன்றி நீக்க முடியும்.

இதனை ஃபேஜ் சிகிச்சை (phage therapy) என்கிறார்கள். இது ஒன்றும் புதிதில்லை. இரண்டாம் உலகப் போர்க் காலத்தில் ரஷ்யா தன் இரும்புத் திரைக்கு அடியில் இந்தச் சிகிச்சை முறையில் எக்கச்சக்க ஆய்வுகள் செய்துகொண்டிருந்தது. அலெக்ஸாண்டர் ஃப்ளெம்மிங், ஆன்டிபயாட்டிக்குகளைக் கண்டுபிடித்தவுடன், ஃபேஜ் சிகிச்சை அம்போ என்று விடப்பட்டது. இப்போது தூசு தட்டிக் கொண்டிருக்கிறார்கள்.


 இன்னொரு பத்து வருடத்தில், மெடிக்கல் படியேறி, “அண்ணா தொண்டை கரகரங்குது‌. தண்ணி மாறுனதுல பிரச்சனை. ஒரு நல்ல ஃபேஜ் டானிக் குடுங்களேன்” என்று கேட்டு வாங்கும் நாள் வந்துவிடும். காத்திருங்கள்.

திரை: தர்மத்தின் குரல் – ஆமருவி தேவநாதன்.





இடதுசாரிச் சார்புள்ள ஒரு லிங்காயத் வகுப்புப் பெண், தனது வீட்டின் எதிர்ப்பையும் மீறி அதே இடதுசாரிச் சார்புள்ள இஸ்லாமிய இளைஞரை மணக்கிறாள். வாழ்வு கசந்து போக, இறந்து போன காந்தீயவாதியான தன் தந்தையின் வீட்டிற்கு வந்து அவரது நூலகத்தில் உள்ள நூல்களைப் படிக்கிறாள். அதன் மூலம் இஸ்லாமிய அரசர்களின் செயல்பாடுகள் குறித்த இடதுசாரிகளின் பொய்யையும் புரட்டையும் உணர்கிறாள். முகலாயர் தொட்டு நடந்த கொடுங்கோல் அரசுகளின் உண்மைகளை உலகுக்கு எடுத்துரைக்கிறாள். இதுதான் கதை.

இடதுசாரிச் சிந்தனைகள் நமது நாட்டின் வரலாறு குறித்த பொய்யுரைகளைப் பரப்பி வந்துள்ளது நாம் அறிந்ததுதான் என்றாலும், அவர்கள் காட்டும் வரலாறு எந்த அளவிற்கு உண்மையிலிருந்து வேறுபடுகிறது என்பதை இந்த நூலில் கன்னட எழுத்தாளர் பைரப்பா தெளிவாக எடுத்துக் காட்டுகிறார்.

பைரப்பாவின்ன் கதை சொல்லும் உத்தி அலாதியானது. கதைக்குள் கதை வைத்து, இரண்டு கதைகளும் ஒருங்கே நிகழும் வண்ணம் செய்துள்ளார். கதைகளில் வெளிக்கதை தற்காலத்தில் நிகழ்வதாகவும், அக்கதையின் கதை மாந்தர் லக்ஷ்மி (எ) ரஸியா, தான் எழுதும் வரலாற்றுக் கதையின் கதைமாந்தனான முன்னாள் ஆணும் இந்நாள் நபும்ஸகனுமான ஒரு பாத்திரம் தனது கதையைச் சொல்வதாகப் படைத்துள்ளது, ஒரே நேரத்தில் வரலாறு நிகழ்ந்தவண்ணம் இருக்க, அப்போதே அதற்கான விமர்சனமும் லக்ஷ்மி பாத்திரத்தின் மூலம் கிடைக்கப்பெறுவது என்று அமைந்துள்ளது, பல நேரங்களில் நாமே நபும்ஸகனாகவும், அதேநேரம் நமது எண்ண ஓட்டங்களை லக்ஷ்மி வாயிலாக நாமே கேட்பதாகவும் அமைகிறது. இந்த அசாத்யமான உத்தியினால் நாம் தற்காலத்தில் இருந்து வரலாற்றை விமர்சித்தவாறே, விமர்சிக்கும் வரலாற்றிலும் இடம்பெறுகிறோம்.

கதைக்குள் உள்ள கதை இஸ்லாமிய அரசர்களின் கொடிய வழிமுறைகளை அப்படியே காட்டுகிறது. அக்பர் முதல் அவுரங்கசீப் வரையிலான மன்னர்கள் புரிந்த அட்டூழியங்கள், அவர்கள் முக்கியமாகக் கோவில்களை இடித்த வழிமுறைகள், பண்டிதர்களையும், பெண்களையும் நடத்திய விதம் என்று பக்கத்திற்குப் பக்கம் கொடூரம். இதுவரை பொதுவெளியில் தெரியாத கொடூரங்கள்.

இஸ்லாமிய அரசர்கள் ராஜபுத்திர வம்சத்தினரை வென்றால் ஒன்று கொல்கிறார்கள் அல்லது பிறப்புறுப்பு சிதைப்பு, விதை சிதைப்பு மூலம் நபும்ஸகர்களாக ஆக்குகிறார்கள். அம்மாதிரியானவர்களை அந்தப்புரத்தில் ராணிகளுக்குச் சேவகம் செய்யப் பணிக்கிறார்கள். பலரை ஆண் அரசர்களே தங்களது காம இச்சைகளுக்குப் பயன்படுத்துகிறார்கள். தொடர்ந்து வரும் இம்மாதிரியான சம்பவங்கள் பல இந்த நூலில் இடம் பெற்றுள்ளன.

ராஜபுத்திர இளவரசன் ஒருவனின் அனுபவங்களைக் கூறுவதாக அமைந்துள்ள இந்த நூலில் மனதைக் கலங்க வைக்கும் பல சம்பவங்கள் இடம்பெற்றுள்ளன. கட்டிளம் காளையான இளவரசன், சரண் அடையாததால் நபும்ஸகனாக்கப்படுகிறான். பிறகு மதம் மாற்றப்படுகிறான். அதன் பின்னர் இஸ்லாமிய அரசனின் அந்தப்புரத்தில் பணி செய்யப் பணிக்கப்படுகிறான். பல்லாண்டுகள் கழித்து, தீயில் விழுந்து இறந்துவிட்டதாக நினைத்த தனது மனைவியைப் பணிப்பெண் உருவில், பல இஸ்லாமிய அரசர்கள் வழியாகப் பிறந்த குழந்தைகளோடு காண்கிறான். நம்புஸகத் தன்மையால் உண்டான கழிவிரக்கம் மேலிடப் பேசும் முன்னாள் கணவனும், தனது கணவன் ஆண்மை இழந்து நிற்பதைக் கண்டு குமுறும் முன்னாள் மனைவியும் சந்திக்கும் நேரத்தில் நடக்கும் பேச்சுவார்த்தைகள் படிப்பவர்களைப் பதைபதைக்கச் செய்வன.

இளவரசன் வாயிலாகக் காசி விஸ்வநாதர் ஆலயம் அழிப்பையும், ரஸியா (லக்ஷ்மி) வாயிலாக ஹம்பி கோவில்கள் அழிப்புப் பற்றியும் நாம் அறிந்துகொள்கிறோம். இரண்டு நிகழ்வுகளும் காலத்தால் வேறுபட்டிருந்தாலும் இரண்டையும் இணைத்து அளித்துள்ள யுக்தி மூலம் பைரப்பா பிரகாசிக்கிறார்.

ஹம்பியில் இன்றும் உள்ள சிதைந்த நரசிங்கம், மஹாவிஷ்ணு முதலானவர்களின் சிற்பங்களை சைவர்கள்தான் உடைத்தார்களே அன்றி, இஸ்லாமியர்களோ முகலாய மன்னர்களோ உடைக்கவில்லை என்ற பரப்புரை வெகு காலமாக நடைபெற்று வந்துள்ள நிலையில், இந்த நூல் வாயிலாக பைரப்பா அந்தப் பரப்புரைகளைத் தவிடு பொடியாக்குகிறார். சைவ, வைணவப் பூசல்களால் ஹம்பி அழியவில்லை என்பதைச் சரியான தரவுகளுடன் நிறுவுகிறார் ஆசிரியர்.

இடதுசாரிப் போர்வையில் குளிர் காயும் எழுத்தாளர்கள் மூலம் பாரதத்தின் பண்டைய வரலாற்று உண்மைகள் எப்படி இரட்டிப்பு செய்யப்படுகின்றன என்பதை இடதுசாரிப் பேராசிரியர் ஒருவரின் பாத்திரத்தால் உணர்கிறோம். சுதந்திர பாரதத்தின் 70 ஆண்டுகால வரலாற்றில் இடதுசாரிப் பார்வைகள், அவர்கள் சார்ந்த கல்விக் கழகங்கள், ஊடகங்கள் முதலானவை உண்மை வரலாற்றை எப்படி மழுப்பி, மக்களைக் குழப்பி, அன்னிய சக்திகளின் உதவியுடன் எம்மாதிரியான தேசத்துரோகச் செயல்களில் ஈடுபட்டன என்பதை நாம் அறிய உதவுகிறார் ஆசிரியர். திப்பு சுல்தான் பற்றிய ஆய்வுகள் ஒரு உதாரணம்.

கலைஞர்கள், எழுத்தாளர்கள், பேராசிரியர்கள் என்கிற பெயர்களில், உண்மையான வரலாற்றைச் சிதைக்கும் பணியில் ஈடுபட்டிருந்த பலர் இந்த நூல் வெளிவருவதை எதிர்த்தனர் என்பதே ஆசிரியர் பைரப்பா சரியான வரலாற்றைத்தான் எழுதுகிறார் என்பதற்கான நிமித்தம் என்று நாம் கொள்ளலாம்.

இந்த நூலை எழுதுவதற்கு ஆசிரியர் மேற்கொண்டுள்ள ஆராய்ச்சி மெய்சிலிர்க்க வைக்கிறது. முகலாயர் கால ஆவணங்கள், ஆங்கிலேய, ஐரோப்பிய ஆவணங்கள் என்று சுமார் 135 ஆதாரங்களை மேற்கோள் காட்டுகிறார் ஆசிரியர்.

கன்னடத்தில் ‘ஆவரணா’ என்று வெளியாகி, பின்னர் ‘The Veil’ என்று ஆங்கிலத்தில் மொழிபெயர்க்கப்பட்டு, தற்போது தமிழில் ‘திரை’ என்று வெளிவந்துள்ள இந்த நூலை விஜயபாரதம் வெளியிட்டுள்ளது. ஆசிரியருக்கும், வெளியீட்டாளர்களுக்கும் அனைத்து பாரதீயர்களும் நன்றிக் கடன் பட்டுள்ளார்கள்.

இந்த நூலை ஒரே அமர்வில் படிக்க முடியவில்லை. ஒவ்வொரு அத்தியாயத்தின் தாக்கமும் வடிய ஓரிரண்டு நாட்கள் பிடித்தன. பெரும் மன உளைச்சலையும் மன அழுத்தத்தையும் ஏற்படுத்தும் வரலாற்று உண்மைகளைக் கொண்ட இந்த நூலை நமக்கு அளித்த ஆசிரியர் பைரப்பா அவர்களுக்கு நமது சிரம் தாழ்ந்த வணக்கங்கள்.

அவர்கள் அப்படித்தான் – ஹரன் பிரசன்னா




அப்பட்டமான வணிகத் திரைப்படங்கள் தரும் கலைச் சீரழிவை விட நாம் அதிகம் பயம்கொள்ளவேண்டியது, விருதுத் திரைப்படங்கள் அல்லது மாற்றுத் திரைப்பட முயற்சிகள் என்ற போர்வையில் வரும் முதிராத் திரைப்படங்களையே. தமிழில் இதுபோன்ற முயற்சிகள் முற்போக்கு வேடம்தாங்கி வருவதை நாம் தொடர்ச்சியாகப் பார்க்கலாம். குற்றம் கடிதல் போன்ற திரைப்படங்களின் தொடர்ச்சியாக சமீபத்தில் வந்த திரைப்படம் ‘கடுகு.’ கடுகுதானே என்று தள்ளிவிட்டுப் போய்விடமுடியாது.

புலிவேஷம் போட்டு ஆடும் கலைஞன் ஒருவனைச் சுற்றி எடுக்கப்பட்டிருக்கும் கதை. புலிவேஷம் போடும் கலை பற்றியெல்லாம் கவலைப்படாமல், அவனுக்குள் இருக்கும் மனிதத் தன்மையை மட்டுமே மையமாகக் கொண்டு மற்ற வலையைச் சுற்றி இருக்கிறார்கள். ஒரு முற்போக்குத் திரைப்படத்துக்கு வேண்டிய அத்தனை பின்னணிகளும் கச்சிதமாக வைக்கப்பட்டிருக்கிறன. கதாநாயகி சிறுவயதிலேயே பாலியல் தொந்தரவுக்கு உள்ளானவள். இன்னொரு சிறுமி அமைச்சர் ஒருவரால் பாலியல் தொந்தரவுக்கு உள்ளாக்கப்படுகிறாள். சிறுமியைக் காப்பாற்றச் செல்லும் கதாநாயகி வன்புணர்வு செய்யப்படுகிறாள். சிறுமி தற்கொலை செய்துகொள்கிறாள். இப்படிச் செல்லும் கதையில் அரசியலுக்காக எம்.எல்.ஏ ஆசைக்காக தன் கண்முன்னே நடக்கும் கொடுமைகளைக் கண்டும் காணாமல் இருப்பதோடு, ஒரு கட்டத்தில் அதற்காக உதவவும் செய்யும் பாத்திரமும் உண்டு. இவற்றை எல்லாம் மனிதத் தன்மையோடும் தன் இயலாமையோடும் எதிர்க்கிறார் கதாநாயகன்.

இப்படத்தில் பதைபதைக்க வைக்கும் காட்சிகள் உண்டு. சிறுமியை வல்லுறவு செய்ய முற்படும் காட்சி பதட்டம் கொள்ள வைக்கிறது. ஆனால் கதாநாயகனாக வரும் ராஜகுமாரன் வெளந்தியாக நடிப்பதாக நினைத்துக்கொண்டு நடித்து நம்மை வன்கொலை செய்கிறார். தனியாளாகப் படத்தைச் சிதைக்கிறார். இறுதிக்காட்சிகள் ஒரு வணிகப்படத்துக்குரிய கதாநாயக பிம்பத்தைத் தூக்கிப் பிடித்து அதுவரை இருந்த போலி யதார்த்தத்தையும் துறக்கின்றன. ஒரே காட்சியில் தன் தவறை உணரும் நடிகர் பரத், அமைச்சரை ஒரே நொடியில் கொலையும் செய்கிறார். இப்படித்தான் இருக்கின்றன நம் மாற்று முயற்சிகள். தங்களுக்குள்ளே ஊறிக் கிடக்கும் வணிகத் திரைப்பட ஆசையை முற்றிலுமாக மறக்கவும்முடியாமல், காதலித்த பெண்ணை நினைத்துக்கொண்டே மனைவியுடன் காலம்தள்ளும் வகையில் இவர்கள் படம் எடுக்கிறார்கள்.

ஆனால், இந்த மாற்று முயற்சிகளில் இவர்கள் சிலவற்றை மட்டும் மறப்பதே இல்லை. ஹிந்து மதத்தைப் பற்றிய விமர்சனங்களும், மற்ற மதங்களை மெல்ல பின்னணியில் தூக்கிப் பிடிக்கும் முயற்சிகளுமே அவை. ‘கடுகு’ திரைப்படத்தில் குழந்தைகள் வேடமிட்டுக் கேள்விகள் கேட்கின்றன. மூன்று மதச்சின்னங்கள் அணிந்த குழந்தைகள் அக்கேள்விகளை எதிர்கொள்கின்றன. ஒட்டுமொத்தமாக எல்லா மதங்களின் மீதும் கேள்விகள் வைக்கப்படுகின்றன என்ற போர்வையில் இயக்குநர் விஜய் மில்டன் ஒரு குழந்தை பாத்திரம் மூலம் மிகத் தெளிவாக ஒரு கேள்வியைக் கேட்கிறார். “எல்லா இடத்துலயும் சாமி இருக்குன்னா கோவில் எதற்கு? அதுலயும் இன்னொரு கோவிலை இடிச்சுட்டு அங்க கோவில் எதுக்கு?” என்பதுதான் கேள்வி. அதாவது இத்தனை தூரம் நாடே விவாதித்த, உச்சநீதிமன்றம் வரை சென்று முதலில் அங்கே கோவில் இருந்ததற்கான ஆதாரங்களை அகழ்வாராய்ச்சி நிரூபித்துள்ளது என்பது போன்ற வரலாற்றுச் சிறப்பு மிக்க ஆவணங்களையெல்லாம் ஒதுக்கி, ஒரே கேள்வியில் ஒரு பொதுப்புத்தியைக் கொண்டுவந்து நிறுத்துகிறார் விஜய் மில்டன். இப்படித்தான் பொதுப்புத்தியைப் பயன்படுத்திக்கொள்வதும், பொதுப்புத்தியை உருவாக்குவதும். இந்நிகழ்ச்சி நடைபெறும் பள்ளி, கிறித்துவப் பள்ளி.

அதாவது, தமிழ்த் திரைப்படங்களின் முற்போக்காளர்கள் தங்கள் திரைப்படங்களில், கிறித்துவர்களுக்கும் அன்புக்கும் சேவைக்கும் இடையே ஒரு பாலத்தையும் பொதுப்புத்தியையும் தொடர்ச்சியாக உருவாக்கி வருவதை நாம் பார்க்கலாம். நம்மையுமறியாமல் நமக்குள் ஏற்றி வைக்கப்பட்டிருக்கும் கருத்து இது. கமல் போன்ற நடிகர்கள் ஹிந்து என்றால் அவனைக் கெட்டவனாகக் காண்பிப்பதையும், கிறித்துவர் என்றால் அவர் சேவையாளர் என்றும் காட்டுவதைப் பார்த்திருக்கிறோம். இப்படத்திலும் அப்படி காட்சி வருகிறது. சேவை மனப்பான்மை கொண்ட ஆசிரியை கிறித்துவ பள்ளியில் வேலை செய்கிறார். அது என்ன பள்ளி? எப்படி இப்படி கலைகளுக்கெல்லாம் முக்கியத்துவம் கொடுக்கிறார்கள்? அப்படி ஒரு பள்ளி எங்கே உள்ளது? தனியார் பள்ளியா? அரசுப் பள்ளியா? தனியார் பள்ளி என்றால் யார் நடத்துகிறார்கள்? கருணையே வடிவான அப்பள்ளிக்கு வருவாய் என்ன? அப்பள்ளியின் நோக்கம்தான் என்ன? இதெல்லாம் ஒரு பொருட்டா என்ன? வழக்கத்திலிருந்து மாறிச் செயல்படும் ஒரு பள்ளி கிறித்துவப் பள்ளியாக இருப்பது முற்போக்குக்கு எத்தனை வசதி.

சிறுமி தற்கொலை செய்துகொள்ளும் காட்சி மிக முக்கியமானது. என்ன செய்தும் சிறுமியின் அகமனபாதிப்பு போகாததால், அச்சிறுமியின் தாய் (முதல் தேர்வு தர்காதான், தர்காவில் தண்ணீர் தெளித்தும் குணமாகாததால் என்று புரிந்துகொள்ள ஏதுவாக ஒரு வசனம் வருகிறது) கருப்பசாமி கோவிலுக்குக் கூட்டிச் செல்கிறார். கோவிலின் பூசாரி, “என்கிட்ட வந்துட்டேல்ல, எல்லாம் சரியாகிடும்” என்று சொல்லி, பரிகாரம் சொல்கிறார். கோவில் குளத்தில் மூன்று முறை முங்கினால் சரியாகும் என்கிறார். இரண்டாம் முறை முங்கும்போதே தற்கொலை செய்துகொள்கிறாள் சிறுமி. அக்காட்சியின் இறுதிச் சட்டகம் ஒரு தேவாலயத்தின் சிலுவையில் உறைகிறது. இதை எப்படிப் புரிந்துகொள்வது? ஹிந்துக்கடவுகள் கைவிட்டதை கிறித்துவம் பார்த்துக்கொண்டுள்ளது என்றா? தர்காவில் குணமாகவில்லை என்றாலும் சாகாத சிறுமி, கோவிலின் பரிகாரத்தில் செத்துப் போக முடிவெடுக்கிறாள் என்றா? எல்லா மதங்களும் பார்த்துக்கொண்டிருக்கும்போதே சிறுமி செத்துப் போகிறாள் என்றா? இயக்குநரின் புத்திசாலித்தனமான பதிலும், முற்போக்கு ஆதரவாளர்களின் சாக்கும் இந்த பதிலாகத்தான் இருக்கும். ஆனால் எப்படி எல்லா மதங்களும் பார்க்கும்போது சாகும் ஒரு சிறுமியின் சாவுக்காட்சி இந்து மத நேர்ச்சையின்போது மட்டும் சரியாக நிகழ்கிறது? அதற்கு முன்பு எத்தனையோ காட்சிகளில் அச்சிறுமி தற்கொலை செய்து கொள்ளாதது ஏன்? இங்கேதான் உள்ளது பொதுப்புத்தியை உருவாக்கும் சாமர்த்தியம்.

‘குற்றம் கடிதல்’ திரைப்படத்தில் புரோகித பிராமணரைத் திட்டும் கம்யூனிஸ முற்போக்குவாதி, கிறித்துவ வீட்டில் சேவையைக் கண்டதும் மனம் சாந்தம் கொண்டு அமைதியாகப் பேசுவதும், கர்த்தர் பார்வைக்குத் தெரிவதைவிட சமீபிக்கிறார் என்று பைக் கண்ணாடியில் கவிதைத்துவமாகக் காட்டுவதும் சும்மா இல்லை. எல்லாவற்றிலும் ஒரு தெளிவான கணக்கு உள்ளது. செல்லுபடியாகும் கணக்கு.

இந்து மதம் தன்னைத்தானே எப்போதும் விமர்சித்துக்கொண்டும் புதுப்பித்துக்கொண்டும் உள்ளது. எனவே முற்போக்குப் போர்வையில் உள்நோக்கத்தோடு செய்யப்படும் விமர்சனங்களில்கூட உண்மை இருக்குமானால் அதை ஹிந்து மதம் ஏற்றுக்கொண்டு, அதையும் கடந்து செல்லும் என்பதை நாம் வரலாற்றில் பார்த்துக்கொண்டேதான் இருக்கிறோம். ஒருவகையில் இவ்விமர்சனங்கள்கூட ஹிந்து மதத்துக்கு வளம் சேர்ப்பவையே என்று ஏற்றுக்கொள்ளும் பக்குவம் ஹிந்துக்களுக்கு உண்டு. இப்பக்குவம் இல்லாத மதங்களை நோக்கிப் பேசுவதே உண்மையான முற்போக்கு எண்ணத்தின் முதன்மையான பணியாக இருக்கவேண்டும். நோக்கம் உண்மையான முற்போக்கு எண்ணம் இல்லை என்றால், இப்படி எளிமையான இலக்காக இந்து மதத்தை மட்டுமே குறை சொல்லத் தோன்றும். ஏனென்றால் ஹிந்து மதத்தைப் பற்றிக் குறை பேசுவதுதான் பாதுகாப்பானது. இதை மிகத் தெளிவாகவே புரிந்து வைத்திருக்கிறார்கள் போலி முற்போக்காளர்கள்.

அனைத்து முற்போக்காளர்களும் தங்களுக்கு நேரம் போகாத போதெல்லாம் கொண்டாடும் திரைப்படமான ‘அவள் அப்படித்தான்’ திரைப்படத்தில் ஒரு காட்சியில் வசனம் ம்யூட் செய்யப்பட்டிருக்கும். நான் பார்க்கும் பிரதியில்தான் கோளாறோ என்ற சந்தேகம் வந்து நண்பர்களைக் கேட்டேன். படத்திலேயே அப்படித்தான் என்றார்கள். பர்தா போட்டுக்கொண்டு ஒரு முஸ்லிம் பெண் பேசும் காட்சி அது. படத்தில் எல்லாவற்றையும் சகட்டுமேனிக்கு விமர்சித்த உயர்தர முற்போக்காளர் இயக்குநர் ருத்ரய்யா எப்படி இதை மட்டும் ம்யூட் செய்தார்? தோன்றும்போதெல்லாம் விமர்சனம் எழுதிய விமர்சகர்கள் ஒருவராவது இதைப் பற்றிச் சொல்லி இருக்கிறார்களா என்று தேடினேன். யாரும் மூச்சே விடவில்லை. இஸ்லாம் பெண்ணின் கருத்தை அப்படியே வெளியிடுவது அத்தனை புத்திசாலித்தனமல்ல என்று முற்போக்கு இயக்குநருக்குப் புரிந்திருக்கிறது. என்ன வேண்டுமானாலும் சொல்லிவிட்டு தைரியமாக எதிர்த்து நிற்க ஹிந்துக்கள்தான் வசதி. ருத்ரய்யா ஏன் இப்படிச் செய்தார் என்று சமீபத்தில் ஃபேஸ்புக்கில் ஒரு நண்பர் விளக்கம் கொடுத்தார். பர்தா அணிந்த முஸ்லிம் பெண்களின் குரல் நசுக்கப்பட்டிருப்பதை சிம்பாலிக்காகக் காட்ட முயன்றாராம் ருத்ரய்யா. சொன்னவர் பொய் சொல்பவரில்லை. எனவே அவருக்காக இதை ஏற்றுக்கொண்டாலும் சில கேள்விகள் மிச்சமிருக்கின்றன. இப்படி சிம்பாலிக்காகக் காட்டவே தான் அந்தக் காட்சியில் குரலில்லாமல் வைத்ததாக ருத்ரய்யா எங்காவது பதிவு செய்திருக்கிறாரா? இல்லை! அந்தப் படம் எப்படி எடுக்கப்பட்டது, என்ன என்ன கஷ்டங்கள் எதிர்கொள்ள நேர்ந்தது, சாப்பாடு போடக் கூட காசில்லாமல் எப்படி கஷ்டப்பட்டுக் கலையைக் காப்பாற்றினோம் என சகலத்தையும் பதிவு செய்த அத்திரைப்படக் குழுவினருக்கு இதை மட்டும் பதிவு செய்ய இன்றுவரை நேரம் கிடைக்கவில்லை. படம் வந்து நாற்பது வருடங்கள்தான் ஆகிறது, இன்னும் நேரம் கிடைத்த பாடில்லை. என்ன சொல்ல? 

அவர்கள் அப்படித்தான்.

********* 

சில பாதைகள் சில பதிவுகள் – 1 (பாதாளக் கரண்டியில் பராசக்தி) – சுப்பு


(1)

பாதாளக் கரண்டியில் பராசக்தி

மதுரையிலிருந்து ராமேஸ்வரம் பயணம்; காசித்துண்டு வாங்க வேண்டும். துணிக் கடைக்குள் நுழைந்து பேரம் செய்கிறேன். பேரம் வலுத்து, வார்த்தை தடித்து ஏதோ சொல்ல வந்த கடை ஊழியரை “எல்லாம் தெரியும்பா” என்று மடக்குகிறேன். இத்தனை நேரம் பொறுமையாக இதைக் கவனித்துக் கொண்டிருந்த முதலாளி, கல்லாவை விட்டு இறங்கி என் அருகில் வருகிறார். ஒரு ஆசனத்தை இழுத்துப்போட்டு, “ஐயா, இப்படி உட்காறீங்களா” என்று கேட்கிறார். எனக்கோ எரிச்சலும் கோபமும். “என்ன விஷயம்?” என்கிறேன். “எல்லாம் தெரிந்த ஒருவரை இப்போதுதான் பார்க்கிறேன்” என்கிறார் அவர்.

பேசாமல் வெளியேறுகிறேன்; பின்னர் பலமுறை பலரிடம் இது பற்றிப் பேசுகிறேன்.

இவ்வாறு, நம்மைக் காய வைக்காமல் கனிவாக்கிய நிகழ்ச்சிகள் எத்தனை? தொட்ட மாத்திரத்திலேயே ரசவாதம் செய்த சொற்கள் எத்தனை? இத்தனையும் தந்த இந்த ஜனங்களுக்கு நாம் என்ன செய்ய முடியும்? நாம் என்னதான் முயன்றாலும், செட்டியாரின் வெல்லப் பிள்ளையாரைப் பின்னால் கிள்ளி முன்னால் நிவேதனம் செய்வது போலத்தான் ஆகும். இருந்தும் அனுபவித்ததைச் சொல்வதிலும், சொல்லி அனுபவிப்பதிலும் ஒரு சுவாரஸ்யம் இருக்கிறதல்லவா?

பாழும் கிணற்றில் பாதாளக் கரண்டியைப் போட்டுத் தேடுவதுபோல, என்னுடைய நினைவின் ஆழமான பகுதியைத் தேடிப் பார்க்கிறேன். அங்கே எது தென்படுகிறதோ, அதை எழுத்தில் வடித்து, முதலில் கொடுத்துவிட வேண்டும் என்ற யோசனை.

உள்ளே, உள்ளே போய்ப் பார்த்தால் பல காட்சிகள் மங்கலாக. மற்றபடி ஒரு முகம் தெரிகிறது. மனித முகம் அல்ல. தெய்வ முகமும் அல்ல. தெய்வம் போன்ற முகம். செக்கச் சிவந்த காளியின் முகம். கண்கள் விரிந்து, பற்கள் பளிச்சென்று காளியின் முகம். நெற்றியை நிரப்பிக் குங்குமம், கருப்புப் புருவம், கருப்புக் கண்கள், சட்டென்று, இந்த முகம் விலகி, மீசையுள்ள ஆண் முகம் தெரிகிறது. இதே முகம்தான். இந்தக் காட்சிதான். இந்த பிம்பந்தான். இதைத் தவிர எதுவும் தெரியவில்லை.

உங்களுக்காகப் பின்னணியைச் சொல்கிறேன். எங்கள் ஊர் மாரியம்மன் திருவிழாவில் எலையூர் காளி ரத்தினம் என்பவர் காளி வேடம் போட்டு ஊர்வலமாக வருவார். அவரைப் பிடித்துக்கொண்டு நாலு பேர். அதற்கும் அடங்கமாட்டார். இந்தக் காட்சியை நான் பார்த்தால் பயந்துவிடுவேன் என்று, ஊர்வலம் வரும்போது என்னை வீட்டில் ஒளித்து வைத்திருந்தார்கள். கதவிடுக்கில் பார்த்தது ஓரளவு பதிந்தது.

ஒரு வாரம் கழித்து, நான் வீட்டுத் திண்ணையில் இருந்தேன். காளி ரத்தினம் வந்தார். இவர்தான் காளி என்று என்னால் நம்ப முடியவில்லை. என்னை நம்ப வைப்பதற்காக, அவர் முக பாவத்தை மாற்றிக் காட்டினார்.


ஏழு வயதுச் சிறுவன் நான், பயந்துவிட்டேன். ஜுரம் வந்துவிட்டது. ஜுரத்தில் அடிக்கடி காளி முகம் வந்தது. இதுதான் மனதில் பதிந்துள்ள பிடிமானமுள்ள பிம்பம். இப்போதும் இருக்கிறது. பயம் இல்லை. பராசக்தி இருக்கிறாள்.

குடிநீர் வசதிகூட இல்லாத வாரியங்காவல் கிராமத்தில்தான் நான் பத்து வயதுவரை இருந்தேன் (1950 – 1959). ஊர்ப் புரோகிதரான எங்கள் மாமா வீட்டில் மட்டும் நல்ல நீர்க் கிணறு. வருடத்தில் பாதி நாட்கள் அதுவும் வற்றிவிடும். தண்ணீருக்காகப் பெண்கள், குழந்தைகளோடு கூட்டம் கூட்டமாக வெகு தொலைவு நடந்து பம்ப் செட் கிணற்றுக்கு வருவார்கள். ஐயர் வீட்டுப் பிள்ளை என்ற முறையில் ஏகப்பட்ட உபசரணையோடு தாய்மார்கள் மாற்றி மாற்றி தண்ணீர் இழுத்து ஊற்றி என்னைக் குளிப்பாட்டுவார்கள். இந்த வயதில் நான் தரையில் கால் பதித்ததே இல்லை. ஒரு இடுப்பை விட்டால் இன்னொன்று என்று ஊரே என்னைத் தூக்கிப் பாலூட்டி வளர்த்தது. உண்மைதான். ஒருவர் குழந்தைக்கு இன்னொருவர் பால் கொடுப்பது சாதாரண விஷயம்.

என் தந்தை ரங்கநாதன் இந்த ஜனங்களுக்கு சர்வ வியாபி. சுதந்திரப் போராட்டத்தில் இவர் சிறை சென்றிருந்தார். காந்திய வழியில் மக்களைத் திரட்டி உள்ளூர் ஜமீன்தாரருக்கு எதிராகப் போராட்டங்கள் நடத்தியிருந்தார். முதலியார்களுக்குக் கைத்தறிச் சங்கம், வன்னியர்களுக்குப் பால் பண்ணை, அரிஜனங்களுக்கு தச்சுப் பட்டறை, நியாயவிலைக்கடை, கிராம வங்கி இவை அனைத்தையும் கூட்டுறவு முறையில் உருவாக்கி, திறம்பட நிர்வாகம் செய்தார். வாரியங்காவலைப் போல அருகிலுள்ள பத்துக் கிராமங்களிலும் இவற்றை உருவாக்கினார்.

கணவன் மனைவி தகராறு முதல் கலெக்டருக்கு வரவேற்பு வரை எல்லாவற்றிலும் இவருடைய அடாவடிதான். நொண்டி ஐயரின் சாதனைகள் ஒரு புத்தக அளவிற்கு இருப்பினும் இது என் கதை என்பதால் அவற்றைத் தவிர்த்து விடுகிறேன்.

நயினாவுக்கு – என் தாய் மொழி தெலுங்கு – என் மீது பாசம் அதிகம். ஊர் விவகாரங்களில் ஈடுபட்டிருந்ததால் என்னோடு இருந்த நேரம் குறைவு. வாராவாரம் வெளியூர் போகம் நயினா வரும்போதெல்லாம் எனக்காகப் புத்தகங்கள் வாங்கி வருவார். ஆகவே, மிகச் சிறு வயதிலேயே எனக்கு புத்தகப் படிப்பு அமைந்துவிட்டது. பள்ளிக் கூடத்தில் நுழைவதற்கு முன்பே நான் ஈசாப்பு நீதிக் கதைகளையும், பாரதியார் கவிதைகளையும் படித்திருந்தேன். மற்றவர்கள் அணில், ஆடு என்று கூவும்போது நான் மட்டும் அலங்காரமாக உட்கார்ந்திருப்பேன்.

கிராமத்துப் பள்ளிக் கூடத்தில் காலையில் வகுப்பறைகள் நிரம்பியிருக்கும். மாணவர்களில் சட்டை போட்டவன் நான் ஒருவன்தான். பாதிப்பேர் தலையில் வேப்பெண்ணெய்யோடு வகுப்புக்கு வந்து காமராஜரின் மதிய உணவைச் சாப்பிடும்வரை இருப்பார்கள். பிற்பகலில் இவர்களைப் பார்க்க வேண்டுமென்றால் அருகிலிருக்கும் குட்டையில் தேடலாம்.

கொடுக்கூர் ஆறுமுகம்தான் இந்தப் பிராயத்தில் எனக்கு ஹீரோ. எல்லாம் செவிவழிச் செய்திதான். கொடுக்கூர் ஆறுமுகம் தீவட்டிக் கொள்ளைக்காரன். கொடுக்கூர் ஆறுமுகம் முன்வைத்த காலைப் பின்வைக்க மாட்டான். போகும் வழியில் வீடு இருந்தாலோ, வேலி இருந்தாலோ தாண்டிக் குதித்துதான் போவான். வளைந்தோ, திரும்பியோ போவதில்லை. யாருடைய வீட்டில் கொள்ளையடிக்க வேண்டுமோ அவர்கள் வீட்டுக்கு முதலிலேயே தகவல் தெரிவித்துவிட்டு வருவது அவனுடைய வழக்கம். வந்தவுடன் அவனுக்குத் தேவையான நகையையோ, பணத்தையோ தட்டில் வைத்துக் கொடுத்து விடுவார்கள். அனாவசியமாக அவன் யாரையும் தாக்கியதில்லை. மிகவும் மரியாதையோடு நடந்து கொள்வான். சமயத்தில் கொள்ளை அடிக்கும் வீட்டில் பால் சாதம் சாப்பிடுவதுண்டு. யாரோ ஒருத்தர் பால் என்று சொல்லி மோரை ஊற்றி விட்டதாகவும், மோரில் உப்பு இருந்ததால் உப்பு இட்டவருக்குக் கெடுதி செய்யக்கூடாது என்று பொருளைத் திருப்பிக் கொடுத்து விட்டதாகவும் ஒரு கதை.

போலீஸ் தொப்பிகளைச் சேகரிப்பதுதான் இவனுடைய பொழுதுபோக்கு என்பது இன்னொரு கதை. எல்லாக் கொள்ளைக்காரர்களைப் போலவே ஏழைகளின் நல்லெண்ணத்தையும், அரசாங்கத்தின் விரோதத்தையும் சம்பாதித்துக் கொண்ட கொடுக்கூர் ஆறுமுகம், எல்லாக் கொள்ளைக்காரர்களைப் போலவே வைப்பாட்டியால் காட்டிக் கொடுக்கப்பட்டு போலீஸால் சுட்டுக் கொல்லப்பட்டான்.

மின் வசதி இல்லாத ஊருக்கு மாரியம்மன் திருவிழாவிற்காக ஒருமுறை ஜெனரேட்டர் கொண்டு வந்த ட்யூப்லைட்டை எரிய வைத்தார்கள். அவ்வளவு பிரகாசமான விளக்கைப் பார்த்தறியாத சிறுவர்கள் – நானும்தான் – “வாழத்தண்டு பல்பு டோய், வாழத்தண்டு பல்பு டோய்” என்று கத்திக் கொண்டே வெறி பிடித்தவர்கள் மாதிரி ஊரைச் சுற்றிசுற்றி வந்தோம். எங்கள் ஆட்டம் அடங்க ஒரு மணி நேரம் ஆயிற்று.

ஊரில் கணவன் கொடுமையால் அரளிக் கொட்டை சாப்பிட்டு இளம் பெண்கள் தற்கொலை செய்து கொள்வார்கள். வாயில் மனிதக் கழிவைக்; கரைத்து ஊற்றி அவர்கள் காப்பாற்றப்படுவதும் உண்டு. ஒரு பெண் இறந்து போனால் சாவு வீட்டிலேயே பஞ்சாயத்துப் பேசப்பட்டு சாகடித்தவனுக்கு இறந்தவரின் தங்கையை நிச்சயிப்பதும் உண்டு.

ஒரு நாளைக்கு இரண்டு முறைதான் எங்கள் ஊருக்கு பஸ் வரும். பஸ்ஸை நம்பாமல் வண்டி கட்டிக்கொண்டு, வாரியாரின் கம்ப ராமாயண உரை கேட்பதற்காக அருகிலுள்ள ஜெயங்கொண்ட சோழபுரத்திற்குப் போவோம். நடுத்தெருவில் மேடை போட்டு ஆயிரக்கணக்கான மக்கள் கூடும் அந்தக் கூட்டத்தில் அவர் இடையிடையே கேள்விகள் கேட்பார். சரியான பதில் தருபவர்களுக்கு மேடையிலிருந்து சாத்துக்குடி வீச்சு.

நிகழ்ச்சி அமைப்பாளர்கள் நயினாவுக்கு வேண்டியவர்கள். இவர்கள் மூலமாக வாரியார் தங்கியிருந்த இடத்தில் அவரைச் சந்திக்கும் வாய்ப்பு எனக்குக் கிடைத்தது. அவரைச் சுற்றி ஆரஞ்சுப் பழங்கள். ஆரஞ்சு ஜுஸை அவர் உறிஞ்சுவதை வெகுநேரம் வேடிக்கை பார்த்துக் கொண்டிருந்தேன். பிறகு ஆட்டோகிராப் கேட்டேன்.

“ஆறிப் போன காப்பியும்
அன்பில்லாத மனைவியும் ஒன்று”

என்று எழுதிக் கொடுத்தார்.

அதற்குப் பிறகு நான் யாரிடமும் ஆட்டோகிராப் கேட்டதில்லை.

… தொடரும்

டெஸ்ட் டியூப்பில் இண்டர்நெட் – சுஜாதா தேசிகன்



 

நிக் கோல்ட்மேனுக்கு (கணிதவியலாளர் மற்றும் மரபணு விஞ்ஞானி) அமெரிக்காவிலிருந்து ‘ஃபெட் எக்ஸ்’ மூலம் கூரியர் ஒன்று வந்து சேருகிறது. சுண்டு விரல் அளவுக்கு ஒரு டெஸ்டியூப். ஆனால் காலியாக இருக்கிறது. ஏமாற்றத்துடன் தன் நண்பரிடம் சொல்ல, நண்பர் வெளிச்சத்தில் அதைப் பார்த்தார் கீழே துளி அளவு அழுக்கு மாதிரி ஒரு வஸ்துவைப் பார்த்து “சரியா பாருங்க கீழே ஒட்டிக்கொண்டு இருக்கு” என்றார்.

நிக் உடனே அந்தக் கடுகு சைஸ் அழுக்கைத் தண்ணீரில் கலந்து ஒரு இயந்திரத்துக்கு அனுப்பி அதில் என்ன இருக்கிறது என்று படிக்க ஆரம்பிக்கிறார். படித்து முடிக்க கொஞ்ச நேரம் ஆகும், அதுவரை சில விஷயங்களை உங்களுக்குச் சொல்கிறேன்.

உங்களிடம் முகம் பார்க்கும் கண்ணாடி இருக்கிறதா? அதில் உங்கள் முகத்தைப் பாருங்கள். சுமாராகத் தெரிந்தால் போதும், மேற்கொண்டு படிக்கலாம். என்ன தெரிகிறது? முகம், கண், மூக்கு, முடி… சரி இவை எல்லாம் உயிரணுக்கள் (cells)! நம் உடலில் கிட்டதட்ட பத்து டிரில்லியன் (1000000000000) உயிரணுக்கள் (cells) உள்ளன. தசைகள், குடல், முடி என்று கிட்டதட்ட 200 வகை உயிரணுக்கள் நம் உடலில் இருக்கின்றன. ஒவ்வொன்றும் ஒரு வகை.
மீண்டும் உங்கள் முகத்தைப் பாருங்கள். நீங்கள் பார்க்கும் கண் லென்ஸ் கூட ஒரு வகை உயிரணுதான்! உங்கள் விரல் நுனியில் 2-3 பில்லியன் செல்கள் இருக்கின்றன. செல்லின் அளவு, ஒற்றைத் தலைமயிரின் விட்டத்தில் (diameter) பத்தில் ஒரு பாகம் மட்டுமே.
எலும்பு உடைந்தால் மீண்டும் வளர்கிறது. பல் விழுந்தால் மீண்டும் முளைக்கிறது. ஆல மரத்தின் சின்ன விதையில் இலை, விழுது என எல்லாம் புரோகிராம் செய்யப்பட்டுள்ளன. எதில்? டி.என்.ஏ என்ற மரபணுவில்.

தனுஷின் உண்மையான பெற்றோர் யார்? தனுஷுக்கு டி.என்.ஏ பரிசோதனை!என்பது தினத்தந்தி செய்தியாகி, டி.என்.ஏ பழக்கபட்ட வார்த்தையாகிப் பல நாள் ஆகிவிட்டது. டி.என்.ஏ என்றால். சர்க்கஸில் நாம் பார்க்கும் முறுக்கிவிட்ட நூலேணி மாதிரி ஒரு பிம்பம் என்று இந்நேரம் உங்களுக்குத் தெரிந்திருக்கும். அந்த நூலேணி சமாசாரம்தான் உங்கள் உயிரணுவில் இருக்கிறது.
கொஞ்சம் டெக்கினிக்கலாகப் பார்த்தால் டி.என்.ஏ என்பது ‘டிஆக்சிரிபோநியூக்ளியிக் அமிலம்’ (deoxyribonucleic acid). பல வகை செல்கள் இருக்கின்றன என்று பார்த்தோம். நம் உடலின் அங்கங்கள் எப்படி உருவாக வேண்டும் என்ற தகவல்கள் எல்லாம் இந்த டி.என்.ஏவில்தான் பொதிந்திருக்கின்றன.

இந்த நூலேணிப் படிகளில் விதவிதமான புரோட்டீன்களை எப்படி உற்பத்தி செய்யவேண்டும் என்ற குறிப்பு இருக்கிறது. இந்த ரகசியத்தைத்தான் ஜீன் (Gene) என்கிறார்கள். முக அமைப்பு, நிறம் போன்ற தகவல்கள் எல்லாம் இந்த ஜீன்களில்தான் இருக்கின்றன. எல்லா மனிதர்களின் ஜீன்களும் 98-99% ஒரே மாதிரிதான் இருக்கும். மிச்சம் இருக்கும் 1-2%தான் என்னையும், இதைப் படிக்கும் உங்களையும் வேறுபடுத்துகிறது.
உங்கள் எச்சில், நகம், ரத்தம் என்று எல்லாவற்றிலும் டி.என்.ஏ இருக்கிறது. எல்லாம் உயிரணுதானே! கடித்துத் துப்பிய நகம் மீண்டும் வளர்வது, கொசு கடித்துச் சொறிந்த கீறல் ஆறுவது, அடுத்த வீட்டுப் புளிப்பு தோசை வாசனை, பாடல், நிறம் எல்லாம் இங்கேதான் பதிவு செய்யப்பட்டுள்ளன.

யார் இந்த ரகசியங்களை அதில் எழுதினார்கள்? கடவுள் என்று சொல்லலாம், தலை எழுத்து என்றும் சொல்லலாம்.

கடவுள்தான் டி.என்.ஏவில் ரகசியங்களை எழுத முடியுமா? பென் டிரைவில் எழுதிவைப்பது மாதிரி நாமும் அதில் எழுதிவைக்க முடியாதா? முடியும் என்கிறது விஞ்ஞானம்.
டி.என்.ஏவின் நூலேணியில் நாம் அடுத்த படிக்குச் செல்லாலாம். மரபணுவில் தகவல் பொதிந்திருக்கிறது என்று 1928ல் வழக்கம்போல எலியை வைத்துக் கண்டுபிடித்தார்கள். ஆனால் அப்போது டி.என்.ஏவின் கூட்டமைப்புப் பற்றிக் கண்டுபிடிக்கப்படவில்லை.
எலியை வைத்துச் சோதனை செய்யுமுன் இரண்டு விதமான பாக்டீரியாவை (நுண்ணுயிர்) உங்களுக்கு அறிமுகம் செய்கிறேன். ஒன்று S வகை, இன்னொன்று R வகை. S வகை ஸ்மூத்தாக இருக்கும், ஆனால் நிமோனியாவை ஏற்படுத்தும். R வகை கரடுமுரடாக இருக்கும். ஆனால் சாது என்று மட்டும் தெரிந்துகொள்ளுங்கள்.

எலிக்கு S வகையைச் செலுத்தினார்கள். நிமோனியா வந்து இறந்தது. எலிக்கு R வகையைச் செலுத்தினார்கள், ஒன்றும் ஆகவில்லை. S வகை நுண்ணுயிர்களை வெப்பமூட்டிக் கொன்றுவிட்டுப் பிறகு எலியில் செலுத்தினார்கள். எலிக்கு ஒன்றும் ஆகவில்லை. கடைசியாக R வகையைச் செலுத்தி, கூடவே வெப்பமூட்டிய S வகையையும் செலுத்தினார்கள். எலிகள் மீண்டும் மாண்டன.
வெப்பமூட்டி S வகை நுண்ணுயிர்கள் பொசுங்கினாலும் R வகையுடன் சேரும்போது மீண்டும் நிமோனியா நுண்ணுயிர்கள் உயிர்பெற்றன. அதாவது எங்கோ ஏதோ தகவல் ஒட்டியுள்ளது என்று கண்டுபிடித்தார்கள். 1940ல் அது டி.என்.ஏ என்று கண்டுபிடித்தார்கள்.


இந்தக் கட்டுரையை படிப்பது போல டி.என்.ஏவைப் படிப்பது சுலபம் இல்லை (பல நாள் ஆகும்; டி.என்.ஏ சரடைச் சேமிக்க நிறைய மெமரி வேறு வேண்டும்). உதாரணத்துக்கு டி.என்.ஏவைப் படித்தால் இப்படி இருக்கும் ATCATGCA… ஒவ்வொரு எழுத்தும் ஒரு கூட்டணுவைக் குறிக்கிறது – நியுக்ளியோ-டைடுகள் (nucleotides) அதாவது A-அடினைன், T-தயோமைன், C-சைடோசைன், G-குவானின் என்று பெயர்கள். இவை எல்லாம் புரதங்கள். ஜீன்கள் இவற்றை உண்டு பண்ணுகின்றன. இந்தப் புரதங்களின் வரிசைதான் நம் தலைவிதி. இதில்தான் தகவல் அடங்கியிருக்கிறது.

மனிதனாக இருந்தாலும், வெண்டைக்காயாக இருந்தாலும் டி.என்.ஏ ஒன்றுதான். டி.என்.ஏ தேவையான புரேட்டீன்களை உற்பத்தி செய்கிறது. என்ன விதமான புரோட்டீன் தேவை என்ற தகவல்கள் ஜீன்களில் இருக்கின்றன. அப்பா போன்ற கண்களும், அத்தை போன்ற குணங்களும் பரம்பரை பரம்பரையாக நம் மரபணுவில் ஹார்ட் டிஸ்க் போல் எங்கோ சேமித்து வைக்கப்பட்டுள்ள தகவல்களே!

நாம் சிடி, டிவிடி பென்டிரைவ், கையடக்க ஹார்டு டிஸ்க் போன்றவற்றில் சேமித்து வைத்துள்ள படம், பாடல்கள், வீடியோ, ஓசியில் கிடைத்த பிடிஎஃப் எல்லாம் நம் மரபணுவில் சேமிக்க முடிந்தால்? நகைச்சுவையாகப் பேச ஆரம்பித்து, சேமிக்க முடியும் என்று நம்பமுடியாத சாதனையைச் சாதித்துள்ளனர்.
நாம் தினசரி சாதாரணமாக உபயோகிக்கும் பென் டிரைவில் எப்படித் தகவல்கள் சேமிக்கப்படுகின்றன என்று சரியாக ஐந்து வரிகளில் சொல்கிறேன்.

பென் டிரைவ்களில் ஒரு சிறிய அச்சிடப்பட்ட சர்க்யூட் போர்டு இருக்கிறது. அதில் சிறிய ‘மைக்ரோசிப்’, தகவல்களைப் படிக்க, சேமிக்க உதவுகிறது. குறைந்த மின்சார சக்தி கொண்ட தகவல் சேமிப்பு EEPROM அடிப்படையிலானது. அதில் தகவல் எழுதவோ அழிக்கவோ முடியும். தகவல்கள் எல்லாம் ‘0’ அல்லது ‘1’ ஆகவோ சேமிக்கப்படுகின்றன. படமோ, பாடல்களோ உள்ளே எல்லாம் 0 அல்லது 1. இதை ‘பிட்’, ‘பைட்’ என்று நான்காம் வகுப்புக் குழந்தைகூடச் சொல்லிவிடும்.

நமது தகவல்களின் ‘பிட்’டை மரபணுவின் A, C, T, G பாஷையில் மாற்றி, தகவல்களைப் பிரதிபலிக்கும் மூலக்கூறை அமைக்க முடிந்தால்? கட்டுரை ஆரம்பத்தில் நிக் கோல்ட்மேன் நினைவிருக்கிறதா?

2011 பிப்ரவரி 16 அன்று ஜெர்மனியில் ஒரு ஹோட்டலில் நிக் கோல்ட்மேன் சக மரபணு ஆராய்ச்சியாளர்களுடன் பேசிக்கொண்டிருந்தார். “மரபணு சேமிக்க நிறைய மெமெரி தேவைப்படுகிறது, செலவும் அதிகமாகிறது” என்றார். அப்போது ஒருவர் “பேசாம மரபணு தகவல்களைச் சேமிக்க மரபணுவையே உபயோகிக்க வேண்டியதுதான்” என்று ஜோக்காக கமெண்ட் அடிக்க, ‘சபாஷ் நாயுடு’ போஸ்டரில் பல்ப் எரிவது போல ஐடியா உதயமாகி “ஏன் அப்படிச் செய்ய கூடாது” என்று டேபிளில் இருந்த ‘டிஷ்யூ’ பேப்பரில் அவர்கள் ஐடியாக்களை எழுத ஆரம்பித்தார்கள்.

இரண்டு வருடம் கழித்து தாங்கள் செய்த சோதனை வெற்றி என்றார்கள்!

என்ன செய்தார்கள்? சொல்கிறேன். ஷேக்‌ஸ்பியர் நாடகத்தின் ஒரு பகுதி, புகழ்பெற்ற மார்ட்டின் லூதர் கிங்கின் சில நிமிடப் பேச்சின் MP3 வடிவம், முதல் டின்.என்.ஏ பற்றிய ஆராய்ச்சிக் கட்டுரை, அவர்களது ஆராய்ச்சிக் கூடத்தின் படம், இவர்கள் செய்யும் ஆராய்ச்சி பற்றிய கட்டுரை என்ற ஐந்தையும் டி.என்.ஏ குறியீடாக மாற்றினார்கள். “Thou art more lovely and more temperate” என்ற சேக்‌ஷ்பியர் வரியை டி.என்.ஏ குறியீடாக “TAGATGTGTACAGACTACGC” மாற்றி இதை இணையம் வழியாக அமெரிக்காவிற்கு அனுப்பினார்கள். அவர்கள் அதைச் செயற்கை முறையில் தயாரிக்கப்பட்ட (Synthetic DNA) மரபணுவில் குறியீடாகச் செலுத்தி (கலர் பிரிண்டர் மாதிரி இந்த டி.என்.ஏவை அச்சடிப்பார்கள் என்று வைத்துக்கொள்ளுங்கள்) டெஸ்டியூபில் பேக் செய்து அனுப்பினார்கள். கட்டுரையின் ஆரம்பத்தை மீண்டும் ஒருமுறை படியுங்கள். டெஸ்டியூபின் கீழே ஒட்டிக்கொண்டு இருந்த அந்தத் துளியூண்டைத் தண்ணீரில் கலந்து அதைப் படித்தபோது அவர்கள் அனுப்பிய ஷேக்‌ஸ்பியர் வரிகள், எம்.பி3 பேச்சு, கட்டுரை, படம் எல்லாம் அச்சு அசலாக அப்படியே ‘மீண்டும்’ கிடைத்தது டி.என்.ஏ வழியாக!

டெஸ்டியூப் உள்ளே ஒட்டிக்கொணடிருந்தது கடுகு சைஸில் இவ்வளவு. இதையே டெஸ்ட்யூப் முழுக்க இருந்தால் அதில் பொதிந்துள்ள விஷயம் கிட்டத்தட்ட பத்து லட்சம் சி.டிக்களில் அடங்கும் தகவல்களாக இருக்கும்.

உலகத்தில் உள்ள தகவல்களை எல்லாம் ஒரு கார் டிக்கியில் அடக்கிவிடலாம்! டி.என்.ஏ படிக்க முன்பு பெரிய இயந்திரங்கள் தேவைப்பட்டன. ஆனால் இன்று வீட்டில் ரத்தத்தில் சக்கரை பரிசோதிக்கும் மீட்டர் போல ஒன்றை வைத்து சில மணி நேரத்தில் படித்துவிடலாம். மரபணுவை அச்சடிப்பதற்கு மட்டும் நிறைய செலவு ஆகிறது, இன்னும் கொஞ்ச நாளில் அதையும் குறைத்துவிடுவார்கள்.

பென் டிரவ் போய் தம்ப் (Thumb) டிரைவ் உங்கள் பேரன் காலத்தில் வந்துவிடும். கட்டை விரலை கம்யூட்டர் யூ.எஸ்.பி ஓட்டையில் நுழைத்தால் பாகுபலி படம் பார்க்கலாம்.

சிடி, பென் டிரைவில் தகவல் சில வருடங்களே இருக்கும். ஆனால் டி.என்.ஏ பல ஆயிரம் வருடங்கள் இருக்கும். குளிர் பிரதேசம், வெளிச்சம் இல்லை என்றால் பல லட்சம் வருடங்கள் கூட இருக்கும். இன்றும் மம்மிகள் கண்டுபிடித்து எடுக்கும்போது அதில் டி.என்.ஏ அழியாமல் இருக்கிறது. அண்டார்ட்டிகாவில் பனியில் உறைந்த பல விங்குகளில் பொதிந்துள்ள டி.என்.ஏவை விஞ்ஞானிகளால் படிக்க முடிகிறது. ‘டி.என்.ஏ’ பென் டிரைவ் வந்துவிட்டால் வழக்கம்போல் தகவல் சேமித்து அதை ஃபிரிட்ஜில் வைத்தால் போதும், ஜன்மத்துக்கும் அழியாது.
செயற்கை மரபணுவில் சேமிக்கலாம், உயிருள்ள டி.என்.ஏவில் சேமிக்க முடியுமா? டி.என்.ஏவை உயிருள்ள அணுக்களில் செலுத்தி அதிலும் வெற்றி கண்டுள்ளார்கள். ஏன் டி.ன்.எவை வைத்து ஆபரேட்டிங் சிஸ்டம், கிளவுட் கம்ப்யூட்டிங், வைரஸ் கூடத் தயாரித்துவிட்டார்கள் என்பதையெல்லாம் இன்னொரு தனி கட்டுரையாக எழுதலாம்.

நிக் கோல்ட்மேன் டிவிட்டரில் இருக்கிறார். இந்தக் கட்டுரையை எழுதும்போது அவரை வெறும் 1,114 பேர் பின்தொடர்கிறார்கள். உலக நாயகன் கமலை 1.77 மில்லியன் பேர் பின்தொடர்கிறார்கள்.

கோமாளிகளின் டி.என்.ஏ!

******* 

ஜி.எஸ்.டி: கட்டுக்கதைகளும் உண்மையும் – ஜெயராமன் ரகுநாதன்


பல வருடங்களுக்கு முன்னால் சென்னையில் மதுரை வீரன் வந்துவிட்டான் என்றொரு பீதி வலம் வந்தது, ஐம்பதைக்கடந்த நம்மைப் போன்ற இளைய சமுதாயத்துக்கு நினைவிருக்கலாம். ஜிம்கானா கிளப்பின் முன்னால் இருக்கும் காமராஜர் சிலையிலிருந்து பாரீசை நோக்கிப் பார்த்தால் வானத்தில் இரண்டு நிமிடங்களுக்கொருமுறை குதிரையில் சரேலென்று நிழலுருவமாகப் பறந்தான் என்று சிலர் துண்டு போட்டுத் தாண்டிச் சொன்னார்கள். எல்லாப் பத்திரிகைகளிலும் எழுதப்பட்ட பரபரப்பான செய்தியாக இது சில நாட்கள் சுற்றியது.

 “மதுரை வீரன் வந்துட்டானாமே! சோதனைதான் மெட்ராஸுக்கு!”

 “நீ பாத்தியா?”

 “இல்லீங்க! பெரியமேட்டுல பார்த்த ஆளு சொன்னாரு!”

இதேபோல எது நிஜமென்பது தெரியாமல் மானாவாரியாக ஜி.எஸ்.டி பற்றிய கருத்துக்களும் கண்டனங்களும் உலா வந்துகொண்டிருக்கின்றன.

“ஜி.எஸ்.டி விடுங்க! அந்த மதுரை வீரன் மெட்ராசுக்கு வந்தது என்னாச்சுங்க?”

சொல்கிறேன். ஆனால் இப்போது இல்லை, கடைசியில். இப்போது ஜி.எஸ்.டி பற்றிய கட்டுக்கதைகளையும் அதன் உண்மைத்தன்மையையும் பார்க்கலாமா?

கட்டுக்கதை #1

“ஒரு சின்ன வியாபாரி எப்படீங்க கம்ப்யூட்டர்ல பில்லு போடுவான்? அத்தோட நாள் முழுக்க இணைய இணைப்பு வேற தேவையாமே?”

இதனால் சிறிய நிறுவனங்கள் நிச்சயம் கஷ்டத்துக்குள்ளாகும்.

உண்மை நிலை

சிறிய வியாபாரிகள் எப்போதும்போல கம்ப்யூட்டர் இல்லாமலும் பில் போடலாம். தொடர்ந்த இண்டர்நெட் தேவையில்லை. மாதாந்திர ஜி.எஸ்.டி கணக்கு தாக்கல் செய்ய மட்டுமே இணைய இணைப்பு தேவை. அதைச் சுலபமாக இண்டர்நெட் செண்டர்களில் போய் செய்துவிட முடியும். பில் போடாமல் தப்பிப்பதுதான் கஷ்டம்.

கட்டுக்கதை #2

“இந்த ஜி எஸ் டியால கட்டுப்படியாகறதில்லீங்க! அல்லா வெலவாசியும் ஏறிப்போச்சே!”

ஜி.எஸ்.டி வரி 18% – 28% இருக்கிறது. இது முந்தைய விற்பனை வரியைவிட (சேல்ஸ் டேக்ஸ்) மிக அதிகம். அதனால் விலைவாசிகள் உயரும். மக்கள் கஷ்டப்படப் போகிறார்கள்.

உண்மை நிலை

மேலோட்டமாகப் பார்த்தால் ஜி.எஸ்.டி வரி அதிகம் போலத் தோன்றுகிறது. ஆனால் முன்பு பல வரிகள் ரசீதில் தென்படாது. உதாரணமாக தொழிற்சாலையில் தயாரிக்கப்பட்ட ஒரு பொருளின் மீது எக்ஸைஸ் வரி, கூடுதல் எக்ஸைஸ் வரி, கொள்முதல் வரி எனப் பலவரிகள் ஏற்கெனவே போடப்பட்டு அந்த வரிகளுக்குப் பின்னால் உள்ள விலையில் விற்பனை வரி போடப்பட்டது. இப்போது எந்த வரியும் இல்லாமல் வெறும் தயாரிப்புச் செலவின்மீது நேராக ஜி.எஸ்.டி மட்டும்தான் போடப்படும். அதனால் பல பொருட்களின் விலை குறையவே செய்யும். ஒரு சின்ன கணக்கு போட்டுப் பார்க்கலாம்.

ஜி.எஸ்.டிக்கு முன்பு:

ஒரு பொருளின் தயாரிப்புச் செலவு ரூ 100. எக்ஸைஸ் 15%, கூடுதல் எக்ஸைஸ் 6% என்று வைத்தால், அந்தப்பொருள் சந்தைக்கு வரும்போது அதன் விலை ரூ 121.90. ஹிந்துஸ்தான் யூனிலீவர் தயாரிப்பான ரின் சோப்பின் விலை ரூ 18.

ஜி.எஸ்.டிக்குப் பின்பு:

அந்தப்பொருள் இப்போது ஜி.எஸ்.டியின் கீழ், 18% இருந்தால் கூட, ரூ 118 தான் ஆகும். ஜி.எஸ்.டிக்குப்பிறகு ரின் சோப்பின் விலை ரூ 15ஆகக் குறைக்கப்பட்டது. அதேபோல துணி துவைக்கும் சர்ஃப் பவுடர் ஜி.எஸ்.டிக்கு முன்பு, ரூ 10க்கு 95 கிராம் தரப்பட்டது. இப்போது அதே ரூ 10க்கு 105 கிராம் கிடைக்கிறது.

கட்டுக்கதை #3

“என்னாங்க இது அநியாயம்! ரொக்கத்தெல்லாம் விட்டொழி! கிரெடிட் கார்டு மொபைல் பேடிஎம்முனு அல்லாரும் பேசறாங்க. இந்த ஜி.எஸ்.டியில ரெண்டு முறை கட்டணும் போலருக்கே!”

உண்மை நிலைஜி.எஸ்.டியின் கீழ் இரண்டு முறை பணம் செலுத்தத் தேவையில்லை. சில நிறுவனங்கள் கிரெடி கார்டு மூலம் பணம் செலுத்தும்போது 1% அல்லது 2% சர்வீஸ் சார்ஜ் வசூலித்துக் கொண்டிருந்தார்கள். உதாரணமாக நீங்கள் ரூ 2,000 தொகையை கிரெடிட் கார்டு மூலம் செலுத்தும்போது கூடவே 1% சர்வீஸ் சார்ஜ் (ரூ 20) செலுத்த வேண்டியிருக்கும். இப்போது அந்தக் கூடுதல் சர்வீஸ் சார்ஜுக்கு ஜி.எஸ்.டி உண்டு. அதனால் நீங்கள் செலுத்த வேண்டிய ஜி.எஸ்.டி வாங்கின ரூ 2,000க்கு இல்லை. அந்த சர்வீஸ் சார்ஜுக்கு மட்டுமே. ஜி.எஸ்.டி வருவதற்கு முன்புமேகூட சர்வீஸ் சார்ஜுக்கு 15% வரி செலுத்திக்கொண்டிருந்தோம். இப்போது கூடுதலாக 3% செலுத்த வேண்டும், அவ்வளவுதான்.

கட்டுக்கதை #4

பிஸினஸ் நிறுவனங்கள் ஜி.எஸ்.டியின் மூலம் பயனடைந்தாலும் அதை நமக்குத் தர மாட்டார்கள். அரசாங்கத்தை ஏய்த்துப் பயன் பெற்றுவிடுவார்கள்!

 உண்மை நிலை

சில மாநில அரசுகள் ஜி.எஸ்.டிக்கும் மேற்பட்டு வரி விதித்திருக்கின்றன. மகாராஷ்டிரா மாநிலம் கார்கள் மீது ரிஜிஸ்டிரேஷன் வரியை 3% உயர்த்தி உள்ளது. கார் நிறுவனங்கள் ஜி.எஸ்.டியினால் ஏற்பட்ட வரிக் குறைப்பில் விலையைக் குறைத்திருந்தன. ஆனால் இந்த ரிஜிஸ்டிரேஷன் வரி உயர்த்தப்பட்டதால் விலை குறைவின் பயன் நுகர்வோருக்குக் கிடைக்கவில்லை.

கட்டுக்கதை #5

“இந்தியா ஒரே நாடு – ஒரே வரி!”

சாரி, இது கொஞ்சம் ஓவர்!

உண்மை நிலை

இந்த வாக்கியங்களோடுதான் ஜி.எஸ்.டி கொண்டுவரப்பட்டாலும் நிஜத்தில் இன்னும் சில பொருட்கள் ஜி.எஸ்.டிக்குள் வராமல் இன்னும் தனி வரி விதிப்புக்குள்ளே உள்ளன. பெட்ரோல் ஒரு முக்கிய உதாரணம். தமிழ் சினிமாவில் ‘கோர்ட்டர்’ என்று இப்போதெல்லாம் கதாநாயகர்களின் வாயாலேயே உச்சரிக்கப்படும் மதுபானங்களுக்கும் ஜி.எஸ்.டி கிடையாது. அவற்றுக்கு வேறொரு வரி விதிப்பு. ஜூலை 5ஆம் தேதி அன்று மும்பையில் பெட்ரோல் ரூ 74.39க்கு விற்கப்பட, டெல்லியில் பெட்ரோல் விலை ரூ 63.12தான்

கட்டுக்கதை #

“ஜி.எஸ்.டி கட்டிவிட்டால் போதும். வேறெந்த வரியும் இருக்காது!”

இல்லை, இருக்கும்!

 “அட என்னாங்க இது? குண்டைத்தூக்கிப்போடறீங்களே!”

உண்மை நிலை

இந்த ஜி.எஸ்.டி தூக்கிச் சாப்பிட்டிருப்பது மத்திய மாநில அரசாங்கங்களின் வரிகள் மட்டுமே. உள்ளாட்சியின் வரிகளை ஜி.எஸ்.டி எடுத்துவிடவில்லை. அந்தந்த மாநிலங்களில் உள்ளாட்சித் துறைகள் இன்னும் வரி வசூலித்துக்கொண்டுதான் இருக்கின்றன. அவை நிறுத்தப்படவில்லை. சினிமாவின் மீது 28% ஜி.எஸ்.டி இருக்க, தமிழ்நாட்டில் கார்ப்பரேஷன் வரியை எடுக்காமல் அப்படியே இருந்ததால் சினிமா டிக்கட் விலை எகிறி, ரூ 100க்குகீழே உள்ள டிக்கட்டுக்கு 48% வரியையும் ரூ 100க்கு மேலே உள்ள டிக்கட்டுகளுக்கு 58% வரியையும் விதிப்பதால் தியேட்டர்காரர்கள் ஸ்டிரைக் செய்து, சில நாட்கள் படம் ஓட்டாமல் இருந்ததெல்லாம் நமக்குத் தெரியும்.

ஆனால் வரி விற்பன்னர்கள், தமிழ்நாட்டின் இந்த வரி விதிப்பு ஜி.எஸ்.டியின் கொள்கைக்கு முரணானதுதான். ஆகவே ஜி.எஸ்.டி கவுன்சில் இதை நீக்க வழி செய்ய வேண்டும் என்று வாதாடுகிறார்கள்.

ஜி.எஸ்.டியினல் இனி வரி ஏய்ப்பு என்பது கஷ்டமாகிவிடும். இது unorganized Sector என்னும் ஒழுங்கு படுத்தப்படாத துறையினரை வரி வலைக்குள் வர வழைக்கும். இதனால், சற்றே விலை குறைந்திருக்கும் இந்த ஒழுங்குபடுத்தப்படாத துறையின் பொருட்களின் விலை ஏற வாய்ப்புள்ளது. மேலும் வரி வலைக்குள் விழுந்துவிடுவதால் இவையும் ஒழுங்குபடுத்தப்பட்ட துறையாகி பொருளாதாரம் உயர்ந்ததுபோல தகவல்கள் அரசுக்குக் கிடைக்கும். உண்மையில் ஒழுங்குபடுத்தப்படாத துறையிலிருந்து ஒழுங்குபடுத்தப்பட்ட துறைக்கு மாறுகிறதே தவிர, நிஜமான வளர்ச்சி (Real Growth) இல்லை. ஆனாலும் வரிகட்டும் நிறுவனங்களின் எண்ணிக்கையும் வரி வசூலும் அதிகரிக்கும் என்பது மறைமுகமாக நன்மையே.

நிதி ஆயோகின் தலைவராக இருந்து வெகு சமீபத்தில் மீண்டும் தன் பேராசிரியர் வாழ்க்கைக்குத் திரும்பிய பொருளாதார நிபுணர் அர்விந்த் பனாகிரியாகூட, “இந்த ஜி.எஸ்.டியின் மேலாண்மை சரியாகத்தான் போகிறது. வளர்ச்சி அப்படி ஒன்றும் பெரிதாக பாதிக்கப்படவில்லை. இந்த நிதியாண்டின் கடைசி காலாண்டில் பொருளாதார வளர்ச்சி 8%ஐத் தொட்டுவிடும் என்பதில் சந்தேகமில்லை” என்கிறார்.

உலகமயமாக்குதல் என்னும் பொருளாதார சித்தாந்தத்தின்படி இந்த ஜி.எஸ்.டியினால் இந்தியாவும் மற்ற முன்னேறிய நாடுகளோடு சேர்ந்து, ‘எளிதாக வியாபாரம் செய்தல்’ (Ease of doing business) அளவுப்படி அதிகமான வெளிநாட்டு முதலீடு இந்தியாவில் வருவதற்கான வாய்ப்பு அதிகரிக்கும். தற்காலச் சிரமங்கள் இருக்கக்கூடும். சில பொருட்களின் விலை அதிகரிக்கவும் செய்யலாம். ஆனால் நீண்டகால அடிப்படையில் இந்த ஜி.எஸ்.டி நிச்சயம் இந்தியப் பொருளாதாரத்திற்கு நல்லதே செய்யும் என்றே நம்பலாம்.

ஆளும் கட்சியினர் ஜி.எஸ்.டியை ‘வாராது வந்த மாமணி’ போலப் புகழ்வதும், எதிர்க்கட்சியினர் அது ஏதோ பெரிய சாபம் போல இழிப்பதும் என இரண்டையுமே நாம் ஊடகங்களில் பார்க்கிறோம். நமது நாட்டின் பொருளாதாரம் இதனால் மேம்படுமா அல்லது அடி வாங்குமா என்பது இன்னும் சர்ச்சையாகவே இருக்கிறது. உண்மை நிலை இரண்டுக்கும் இடையில்தான் இருக்கிறது!

பின் குறிப்பு:

மதுரை வீரனெல்லாம் சும்மா வதந்திதான். சாந்தோமில் உள்ள லைட் ஹவுஸிலிருந்து அடிக்கொருதரம் சுழலும் அந்த விளக்கு வெளிச்சத்தில் குதிரை சவாரி செய்வது போன்ற மன்றோ சிலையின் பிம்பம் வானத்தில் பறப்பதுபோலத் தெரிந்ததாகச் சொன்னார்கள்!

ஆங்கிலவழிக் கல்வியின் அபாயங்கள் – லக்ஷ்மணப் பெருமாள்



 

உலகில் ஆங்கிலத்தின் முக்கியத்துவம் நாளுக்கு நாள் கூடிக் கொண்டே செல்கிறது. நவீன உலகப் பொருளாதார மயமாக்கல் காலத்தில் ஆங்கிலம் உலகின் தொடர்பு மொழியாக முற்றிலுமாக நிலை கொண்டுள்ளது. இன்னும் சொல்லப்போனால் உள்ளூர் ஆட்சி மொழிக்கு அடுத்தபடியாக ஆங்கிலமே இரண்டாம் மொழியாகப் பார்க்கப்படுகிறது. உலகின் புவி வெப்பமயமாதல் மாநாட்டில் தொடங்கி, விளையாட்டு, கலை என அனைத்துத் துறைகளிலும் தமது தாய்மொழிக்கு அடுத்தபடியாக உலகின் தொடர்பு மொழியான ஆங்கிலத்திலேயே மொழிபெயர்க்கப்படுகிறது. பழங்கால இந்தியாவில் சம்ஸ்கிருதத்தில் பல நூல்கள் மொழிபெயர்க்கப்பட்டன. அதைப் போல சமஸ்கிருதம் படித்த பண்டிதர்கள், சம்ஸ்கிருதத்தில் எழுதப்பட்ட பல காவியங்களை, இதிகாசங்களை, தமது சொந்த மொழியில் மொழியாக்கம் செய்தனர். இன்று இந்தியா மட்டுமல்ல, உலகம் முழுவதும் அனைத்தும் ஆங்கிலத்திலேயே மொழிபெயர்க்கப்படுகின்றன. தமது தேசத்தின் பிறமொழிகளில் அவை மொழி மாற்றம் செய்யப்படுவதில்லை.

உலகம் முழுவதும் ஆங்கிலத்தின் தேவையைக் கருத்திற்கொண்டு, ஏறத்தாழ அனைத்து நாடுகளிலும் ஆங்கிலவழிக் கல்வி நிலையங்கள் தொடங்கப்பட்டுள்ளன. உலகம் முழுவதும் 2 பில்லியன் குழந்தைகள் ஆங்கில வழியில் படிக்கின்றனர். வேலைவாய்ப்பு என்ற ஒற்றை மூல மந்திரமே அரசு, சமூகம், பெற்றோர் என அனைத்துத் தரப்பினரையும் ஆங்கிலவழிக் கல்வி என்ற மோகத்தினுள் தள்ளியுள்ளது. இதற்கிடையே ஒவ்வொரு நாட்டின் அரசும் பெரும்பான்மை மக்களால் பேசப்படும் மொழிவழிக் கல்விக்கொள்கைக்கு மட்டும் முக்கியத்துவம் கொடுக்கின்றன. இதனால் குறைந்த எண்ணிக்கையில் பல மொழிகளைப் பேசும் மக்களின் மொழிகளை அடுத்த தலைமுறைக்குக் கொண்டுசெல்வதில் சிக்கல் ஏற்படுகிறது. ஆகையால் பெரும்பாலான மொழிகள் அழிந்து வருகின்றன.

உலகில் 7,103 மொழி பேசுபவர்கள் உள்ளனர். ஒவ்வொரு 14 நாட்களுக்கும் ஒரு மொழி அழிந்து வருகிறது என்பதே சோகமான விஷயம். இந்தியாவில் தற்போது 780 மொழிகள் பேசும் மக்கள் உள்ளனர். கடந்த 50 ஆண்டுகளில் 220 இந்திய மொழிகள் அழிந்துள்ளன. தற்போது 197 இந்திய மொழிகள் அழியும் அபாயத்தில் உள்ளன. பெரும்பாலும் இச்சிறுபான்மை மொழி பேசும் மக்கள் பழங்குடிகள் அல்லது மலைவாழ் மக்கள் என்பது குறிப்பிடத்தக்கது. அரசே 1971க்குப் பிறகு 10,000 க்கும் குறைவான மக்கள் பேசும் மொழியைக் கணக்கில் கொண்டு வருவதை நிறுத்தியுள்ளது. மிகக் குறைந்த அளவிலேயே மிகச் சிறுபான்மையினர் பேசும் மக்களின் மொழியை உயிர்ப்பிக்க அரசு உதவுகிறது. மேலும் இந்திய அரசின் செம்மொழிகளாக 22 மொழிகளே அங்கீகரிக்கப்பட்டுள்ளன. போரோ (Boro) மற்றும் மெய்தி (Meitei) மொழிகள் கூட அழியும் அபாயத்தில் உள்ளன. இவை இரண்டும் அரசால் அங்கீகரிக்கப்பட்ட 22 மொழிகளில் உள்ளன. மொழிகளின் அழிவிற்கு நவீன கல்வி முறையும், மக்கள் இடம் பெயர்தலும், பல மொழிகளுக்கு எழுத்துரு இல்லாமல் இருப்பதும், அரசின் நடவடிக்கைகளும்தான் மிக முக்கியக் காரணங்கள். ஒரு தலைமுறை மறையும் போது அம்மொழியும் மறைகிறது.

 இந்தியாவின் மொழிகள் மற்றும் பண்பாடு காப்பாற்றப்பட, மத்திய, மாநில அரசின் கல்விக் கொள்கையில் உடனடி மாற்றங்கள் தேவைப்படுகின்றன. ஆங்கிலவழிக் கல்விக் கொள்கையை ப்ரீகேஜியிலிருந்து ஆரம்பிப்பது மிகத் தவறான கல்விக் கொள்கையாகும். வீட்டில் பேசும் மொழிக்கும் பள்ளியில் பயிற்றுவிக்கப்படும் மொழிக்கும் மிகப்பெரிய இடைவெளி உள்ளது. மத்திய அரசு இந்தியின் பயன்பாட்டை அதிகரிக்க நடவடிக்கைகள் மேற்கொள்வது கூட எந்த வகையிலும் பலன் தரக்கூடியதல்ல. வேலை வாய்ப்பைக் கருத்திற்கொண்டே பெற்றோர்கள் தங்கள் குழந்தைகளை ஆங்கிலவழிப் பள்ளியில் சேர்க்க விரும்புகின்றனர்.

இந்தியாவில் 17% குழந்தைகள் ஆங்கிலவழிப் பள்ளிக்கூடங்களில் படிக்கின்றனர். ஐந்து (2008-09 to 2013 -14 ) ஆண்டுகளில் ஆங்கில வழிப் பள்ளிக்கூடங்களில் சேர்ந்த மாணவர்களின் எண்ணிக்கை இரட்டிப்பாகியுள்ளது. 2008-09 ல் ஆங்கில வழிப்பள்ளியில் படித்த மாணவர்களின் எண்ணிக்கை 1.5 கோடி. 2013-14 ல் அவ்வெண்ணிக்கை 2.9 கோடியாக உயர்ந்துள்ளது. குறிப்பாக இந்தி பேசும் மாநிலங்களில் அதிக எண்ணிக்கையில் ஆங்கிலவழிப் பள்ளிக் கூடங்களில் குழந்தைகள் சேர்க்கை அதிகமாகியுள்ளது. இதன் பொருள், தென்னிந்தியாவில் ஆங்கில மோகம் இல்லை என்பதல்ல. இம்மாநிலங்களில் ஆங்கிலவழிப் பள்ளிகளில் படிக்கும் மாணாக்கர்களின் எண்ணிக்கை இந்தி பேசும் மாநிலங்களை விடப் பல மடங்கு அதிகம் என்பதை மறந்து விடக்கூடாது.

ஆங்கில வழிப் பள்ளிகளில் படிக்கும் மாணவர்கள் மாநில வாரியாக: காஷ்மீரில் 99.9%, கேரளா 49.2%, டெல்லி 48.6%, ஆந்திரா 44.1%, தமிழ்நாடு 41% இமாச்சலப் பிரதேசம் 30%. காஷ்மீர், மகாராஷ்டிரா, ஆந்திரா, கர்நாடகா, தமிழ்நாடு, டெல்லியின் ஆங்கில வழிப் பள்ளியில் படிக்கும் மாணவர்களின் சராசரி 54%. வட கிழக்கு மாநிலங்களான நாகலாந்து, சிக்கிம் மற்றும் மணிப்பூரில் 80-90% மாணவர்கள் ஆங்கில வழிப் பள்ளியில் படிக்கின்றனர்.

பீகாரில் 4700% மாணாக்கர் சேர்க்கை ஐந்து வருடங்களில் ஆங்கிலவழிப் பள்ளியில் அதிகரித்துள்ளது. இந்தி பேசும் மாநிலங்களில் ஆங்கிலவழிப் பள்ளியில் சேரும் மாணவர்களின் எண்ணிக்கை அதிகரித்துக்கொண்டே செல்கிறது. தமிழ்நாட்டைப் பொருத்தவரை, ஜெயலலிதா, ஏழை மாணவர்களுக்கும் ஆங்கில வழியில் படிக்க விரும்பினால் ஆங்கில வழியில் படிக்கலாம் என அறிவித்த மூன்று ஆண்டுகளில், தமிழக அரசுப் பள்ளிகளில் சேர்ந்த மாணவர்களின் எண்ணிக்கை 3.2 லட்சம். இந்தியா முழுமைக்கும் தாய்மொழியில் படிக்கும் மாணவர்களின் எண்ணிக்கை பல மடங்கு குறைந்துகொண்டே வருகிறது.

 மத்திய அரசும் மாநில அரசும் ஆங்கிலவழிக் கல்விக் கொள்கையை வைத்திருக்கும் வரையில் இந்தியாவில் தமிழ், இந்தி, கன்னடம், மலையாளம், தெலுங்கு மற்றும் இன்னபிற மொழிகள் வளர்வதற்கு வாய்ப்பே இல்லை. இந்த மொழிகள் அழிவதற்கான சாத்தியக் கூறுகள் மிக மிகக் குறைவு. ஏனெனில் கணினி காலக்கட்டத்தில் இம்மொழிகளில் உள்ள அத்தனையையும் சேமிக்க இயலும். அதற்கான தட்டச்சு முறைகள்கூட வளர்ந்து விட்டுள்ள காலகட்டம் என்பதையெல்லாம் மறுப்பதற்கில்லை. அவ்வாறானால் ஏன் இந்த மொழிகளின் வளர்ச்சி சாத்தியமில்லை என்று கேட்கலாம்.

குறைந்தபட்சம் எட்டாம் வகுப்பு வரையாவது தாய்மொழிவழிக் கல்விக் கொள்கை இருக்க வேண்டும். ஆங்கிலம் ஒரு பாடமாக மட்டும் இருக்க வேண்டும். இல்லையெனில் எதிர்கால சந்ததிக்கு வரலாற்றுச் சொற்களோ, கலைச் சொற்களோ தெரியாமல் போகும். கணித மற்றும் அறிவியல் சொற்களுக்கான அர்த்தம் கூடத் தெரியாமல் போய்விடும் அபாயம் உள்ளது. கணித மற்றும் அறிவியல் சொற்களுக்கு இணையான தமிழ் வார்த்தைகள் இருப்பது தெரியாமல் போகும். இப்போதே நிலைமை கிட்டத்தட்ட இப்படித்தான் உள்ளது. இது தொடர்ந்தால் என்ன ஆகும்? தமிழில் எழுதுகிறேன் என்று சொல்லிக்கொண்டே பெரும்பாலான ஆங்கில வார்த்தைகள் தமிழிலும் எழுதப்படும். இன்னும் சொல்லப்போனால், ஆரம்பக் கல்வியிலிருந்து தமிழ் தவிர்த்து மற்ற அனைத்துப் பாடங்களையும் ஆங்கில வழியில் படிப்பதால், தமது தாய்மொழியைக் கூடப் பிழையில்லாமல் எழுதத் தெரியாத சந்ததி உருவாகி இருக்கும். தசம எண்கள், மின்னோட்டம், மின்னூட்டம், மின் காந்தப் புலம் என தமிழில் வார்த்தைகள் இருப்பது கூடத் தெரியாத சந்ததியை உருவாக்குவதில்தான் நமது அரசுகளின் கல்விக் கொள்கை உள்ளது.

நம்மை நாமே முட்டாளாக்குவது என்பது எது தெரியுமா? மத்திய அரசு இந்திக்கு முக்கியத்துவம் கொடுக்க முயற்சிப்பது போல நடிப்பதும், போலியாக இங்குள்ளவர்கள் இந்தியை எதிர்ப்பதும்தான். உண்மையில் தாய்மொழிக் கல்வியோடு இந்தியாவின் ஒரு மொழியையும், ஆங்கிலத்தையும் ஒரேயொரு பாடமாகக் கொண்டு வராத வரையில் அத்தனையும் இந்திய மொழிகளின் வளர்ச்சிக்கு உதவாத ஒன்றுதான். பள்ளியில் தாய்மொழியை மழுங்கடிக்கச் செய்யும் கல்விக் கொள்கையை வைத்துக்கொண்டு இந்திய மொழிகள் வளரும் என்பது நம்பும்படியாக இல்லை.

மொத்தத்தில் ஆங்கிலம் வளரும். தாய்மொழியைப் பிழையின்றி எழுதும் தலைமுறையையும், ஆங்கிலச் சொற்களுக்கு இணையான தாய்மொழிச் சொற்களைத் தெரியாத சமூகத்தையும், ஆங்கில வழியில் படிப்பதால் எதிர்கொள்ள நேரிடும் என்பதில் எந்த ஐயமுமில்லை. சம்ஸ்கிருதத்தைப் பாதுகாக்க மெனக்கெடுவது போல, அரசே தமிழில் ஆவணப்படுத்தவும், தமிழ் ஆர்வலர்கள் இணையத்தில் ஆவணப்படுத்தவும் செய்ய வேண்டிய கட்டாயம் வரலாம். ஒரே ஆறுதல் தமிழ் பிராந்திய மொழியாகவும், ஆட்சி மொழியாகவும் இருப்பதே அதன் வாழ்வை நிர்ணயிக்கிறது. இந்திய அரசின் அலுவல் மொழி திணிக்கப்படுவதை எதிர்ப்பதில் பிழையில்லை என்று சொல்லும் தமிழ்நாட்டில்தான் ஆங்கிலவழிப் பள்ளியில் பயிலும் மாணவர்களின் எண்ணிக்கையும் அதிகரிக்கிறது.

ஆங்கிலம் ஒரு வணிக மொழியாக இருக்கலாம். ஆனால் பண்பாட்டு மொழியாக இருக்க முடியாது. ஆங்கிலம் பணப் பரிமாற்றத்திற்கு உதவலாம். ஆனால் நிச்சயமாக பிராந்திய மொழிகளையும் பண்பாட்டையும் காலப்போக்கில் அழிக்கும்” என்கிறார் மைசூரில் பணிபுரிந்து வரும் பேராசிரியர் ரகுநாத். பண்பாடு வீழ்வதற்கு மிக முக்கியக் காரணமாக அவர் முன்வைப்பது தாய்மொழிவழிக் கல்வி இன்மையைத்தான். பண்பாட்டுக் கல்வியை அழிப்பதில் மிக முக்கியப் பங்கு வகிப்பது ஆங்கிலவழிப் பள்ளிக்கல்விக் கொள்கை என்கிறார். தாய்மொழியில் படிப்பதே பண்பாட்டையும் பேணிக் காக்கும் என்கிறார்.

உலகின் இரண்டாவது மொழியாக ஆங்கிலம் இருப்பதில் பிரச்சினையில்லை. ஆனால் அரசே வேலை வாய்ப்பு என்பதைக் காரணம் காட்டி ஆங்கில வழிப் பள்ளிக் கல்விக் கொள்கையைக் கையில் வைத்திருக்கும் வரை எந்த இந்திய மொழியின் வளர்ச்சியும் சாத்தியமில்லை. ஒரு தேசத்தின் பண்பாட்டை அழிக்க வேண்டுமானால், அந்த தேசத்தின் மொழி அழிந்தால் போதும். அதன் பின்னர் அது கடலில் மூழ்கிய கதையாகவே இருக்கும். அறிவியல்பூர்வமாக தாய்மொழியில்தான் தொடக்கப்பள்ளி சொல்லிக் கொடுக்க வேண்டும் என்று பல ஆய்வுகள் வந்தும், ஆங்கில மோகம் நோக்கி இந்திய சமூகம் செல்வதால் நிச்சயம் பிராந்திய மொழி நலிவுறவே செய்யும். இவற்றை சரிசெய்வது அரசின் கைகளில்தான் உள்ளது. மாறாக அரசுப் பள்ளியிலும் ஆங்கிலவழிக் கல்வி என்ற கொள்கை முடிவுகளையே அரசு எடுக்கிறது. கல்வி இலவசமாக்கப்பட வேண்டும். கட்டாயம் எட்டாம் வகுப்பு வரை தாய்மொழிவழிக் கல்விக் கூடங்கள் மட்டுமே இருக்க வேண்டும். அப்போதுதான் இந்தியாவின் அனைத்து மொழிகளும் வளரும். இல்லையேல் உள்ளூர் அரசியல் சண்டைகள் மட்டுமே மிஞ்சும்.

***** 

http://www.thehindu.com/todays-paper/tp-national/tp-andhrapradesh/lsquoEnglish-a-threat-to-local-languagesrsquo/article16572399.ece

http://timesofindia.indiatimes.com/india/Number-of-children-studying-in-English-doubles-in-5-years/articleshow/49131447.cms

http://blogs.timesofindia.indiatimes.com/Swaminomics/is-premature-english-making-india-a-super-dunce/

http://blogs.economictimes.indiatimes.com/cursor/why-english-should-not-be-the-medium-of-instruction-in-india/

http://economictimes.indiatimes.com/news/politics-and-nation/seven-decades-after-independence-many-small-languages-in-india-facing-extinction-threat/articleshow/60038323.cms

http://economictimes.indiatimes.com/news/politics-and-nation/seven-decades-after-independence-many-small-languages-in-india-facing-extinction-threat/articleshow/60038323.cms

https://thewire.in/144855/india-endangered-languages-need-to-be-digitally-documented/