அயோத்தியின் மனத்துக்கு இனியான் – சுஜாதா தேசிகன்


விக்கிபீடியாவில் அயோத்தியா பற்றி குறிப்பு இப்படி இருக்கிறது – ‘is an ancient city of India, believed to be the birthplace of Rama’ – அதாவது ஸ்ரீராமர் பிறந்த இடம் என்று ‘நம்பப்படுகிறது.’

அக்டோபர் 10 இரவு. பேருந்தில் தூங்கிக்கொண்டு இருந்தபோது “அயோத்தி வந்தாச்சு!” என்று எழுப்பப்பட்டேன். வெளிக்காற்று முகத்தை வருடிய நேரத்தில் எங்கிருந்தோ ராம பஜனை கேட்டது. டியூப் லைட் வெளிச்சத்தில் சில குரங்குகள் தென்பட்டன.

மறுநாள் காலை சரயூ நதியில் குளிக்கச் சென்றபோது, பெரிய சைஸ் குலோப் ஜாமுன் போல் சூரியன் என்னை வரவேற்றது. சூரியோதயத்தைப் பார்ப்பதா குளிப்பதா என்ற தடுமாற்றத்தைத் தாண்டி, சூரியோதயத்தில் சரயூவில் மூழ்கி ரசித்தேன். ‘ஸ்ரஸ்-யூ’ என்பதையே சரயூ என்று நாம் கூறுகிறோம். அதாவது பிரம்மாவின் மனமே உருகி ஒரு பெரிய நதியாக மாறியதாம்.

முக்தி தரும் ஷேத்திரங்கள் ஏழு. அவந்திகா – பாதங்கள், காஞ்சிபுரம் – இடுப்பு, துவாரகா – நாபி, மாயாபுரி (ஹரித்வார்) – இருதயம், மதுராபுரி – கழுத்து, காசி – மூக்கு, அயோத்தி – தலை. முக்தி தரும் ஷேத்திரங்களில் தலையானது அயோத்யா என்று சொல்லலாம்.

அயோத்யா என்றால் சொல்ல முடியாத அழகு என்று பொருள். ஸ்ரீ வேதாந்த தேசிகன் தனது கருட பஞ்சாசத்தில் பெரிய திருவடியின் பார்வையை ‘அயோத்யா’ என்கிறார். அதாவது ஜெயிக்க முடியாத அழகு வாய்ந்ததாம் அவர் திருவடி.

ஆனால் இன்றைய அயோத்யா அதுவும் ‘ராமஜன்ம பூமி’ என்றால் உள்ளூரக் கொஞ்சம் பதற்றம் நம்மைப் பற்றிக்கொள்வதை மறுக்க முடியாது.

நாம் படிக்கும் வரலாறு வடி கட்டியது. ஏதோ ஆங்கிலேயரும், முகம்மதியர்களும் நமக்கு நல்லது செய்தார்கள் போன்ற தோற்றத்துடன் எழுதப்பட்டுள்ளது. ஹிந்துக் கோயில்களின் மீதும், நம் தேசத்தின் மீதும் அவர்கள் புரிந்த தாக்குதலின் சுவடுகளை யாத்திரை முழுவதும் பார்க்க முடிந்தது. இவை எல்லாம் நம் வரலாற்றுப் பாடத்தில் இல்லாத ஒன்று. ஆங்கிலேயர்கள்தான் ரயில்வே, போஸ்ட் பாக்ஸைக் கொண்டு வந்தார்கள் என்று ரிட்டையரான தாத்தாக்கள் பிதற்றிக்கொண்டு இருப்பதற்கு, நம் வரலாற்றைச் சரியாக எழுதாததுதான் காரணம்.

1528ல் பாபர் மசூதி ஒன்று ஸ்ரீராமர் கோயில் இருந்த இடத்தின் மீது மிர் பக்கி என்னும் பாபரின் படைத்தலைவரால் கட்டப்பட்டது. கலவரம் நடந்த பிறகு, ஆங்கிலேயர்கள் கட்டைப் பஞ்சாயத்து செய்து, ஒரு பகுதியில் மசூதியையும், இன்னொரு பகுதியில் கோயிலையும் அனுமதித்தார்கள். 1949ல் ஸ்ரீராம மூர்த்திகளை அங்கே பிரதிஷ்டை செய்தார்கள். 1992ல் அங்கே இருந்த மசூதியை இடித்து மீண்டும் அங்கே ராமரை பிரதிஷ்டை செய்தபோது நடந்தவை எல்லாம் நீங்கள் தொலைக்காட்சியில் பார்த்த வரலாறு.

இந்தியத் தொல்பொருள் ஆராய்ச்சிக் கழகம் (ASI) 2003ல் அகழ்வாராய்ச்சியை மேற்கொண்டு, மசூதியின் அடியில் இருக்கும் கட்டட அமைப்புப் பற்றி விரிவான ஆராய்ச்சி செய்து அறிக்கை சமர்ப்பித்தது. சுமார் 3,000 ஆண்டு பழமை மிகுந்த கட்டட அமைப்புக்கு மேல் மசூதி கட்டப்பட்டதாக அறிக்கை சொன்னது. ராமர் ‘மித்’ இல்லை நமக்கு மித்திரன்.

“எக்கசக்க செக்யூரிட்டியாம்… மொபைல் கேமரா எதுவும் நாட் அலவ்ட்” போன்ற அறிவுரைகளால் உள்ளூர ‘ராம ஜன்ம பூமி’க்குச் சீக்கிரம் செல்லவேண்டும் என்ற பதற்றம் தொற்றிக்கொண்டது.

நம் சடகோபன் திருவாய்மொழியில் –

கற்பார் இராம-பிரானை அல்லால், மற்றும் கற்பரோ?
புல் பா முதலா, புல் எறும்பு ஆதி ஒன்று இன்றியே
நல்-பால் அயோத்தியில் வாழும் சராசரம் முற்றவும்
நல்-பாலுக்கு உய்த்தனன் நான்முகனார் பெற்ற நாட்டுளே?

‘அயோத்தியில் வாழ்கின்ற எல்லா ஜீவராசிகளுக்கும், புல் முதல் எறும்பு வரை, ஆயோத்தியில் இருந்ததால் சுலபமாக பரமபதம் கிடைத்தது. ஸ்ரீராமபிரானுடைய கீர்த்தியை அல்லாமல் வேறு கீர்த்திகளையும் கற்பார்களோ?’

இங்கே ‘நற்பால் அயோத்தி’ என்று நம்மாழ்வார் கூறுவதற்கு நம்பிள்ளை ‘அயோத்தி மண்ணை மிதித்தாலே இராம பக்தி தானாக உண்டாகும்’ என்று விளக்கம் தருவாராம். அதாவது ராமகுணங்கள் நடனமாடுகிற அயோத்தி என்று பொருள்.

ஸ்ரீராமரை பற்றிப் பள்ளியில் எங்கு படித்தேன் என்று யோசித்தேன். Ram killed Ravana. – Active Voice; Ravana was killed by Ram. – Passive Voice. நமக்குத் தெரிந்த ராமர் அவ்வளவே!

ராமாயணத்தில் எவ்வளவு காண்டம் இருக்கிறது, கம்பர், துளசிதாஸ் எழுதிய ராமாயணத்தில் உத்திர காண்டம் இருக்கிறதா போன்ற தகவல்கள் பலருக்குத் தெரியாது. நம் குழந்தைகளின் நிலையை யோசித்துப் பாருங்கள்.

ஒரு மகனாக, ஒரு கணவனாக, ஓர் அரசனாக, ஒரு சகோதரனாக, ஒரு வீரனாக எப்படி வாழ வேண்டும் என்பதற்குச் சிறந்த உதாரணமாக விளங்கிய ஸ்ரீராமரைப் பற்றி நாம் அவர்களுக்குச் சொல்லித் தந்தால் அதுவே சிறந்த வரலாற்றுப் பாடம்.

அயோத்தி முழுவதும் மொத்தம் 12,000 இராமர் கோயில்கள் உள்ளன என்பார்கள். அதனால் ‘பார்க்கும் மரங்களெல்லாம் நந்தலாலா’ மாதிரி இங்கே போகும் இடம் எல்லாம் ராமர் கோவில்தான்.

அயோத்தியாவில் பார்க்கும் கல், கோயில், மண்டபம், மூர்த்திக்குப் பின் ஏதோ ஒரு ராம கதை இருக்கிறது. இரண்டு நாளில் இவை எல்லாவற்றையும் சேவித்துவிட்டு வருவது என்பது பிரம்மப் பிரயத்தனம். சில முக்கியமான கோயில்களை மட்டும் அனுபவித்து சேவிப்பது என்று முடிவு செய்து புறப்பட்டோம்.

முதலில் சென்ற கோயில் கனக பவன். ஸ்ரீராமர், சீதையின் அந்தப்புரம். இதை கைகேயி, ராமர்-சீதைக்குக் கல்யாணப் பரிசாகக் கொடுத்தார். அங்கே பல மூர்த்திகள் இருந்ததால், குழப்பத்துடன், “இதில் யார் ராமர், சீதை?” என்றேன். “எல்லாமே ராமர் சீதைதான்” என்று பதில் கிடைத்தது! அங்கே ஒரு சின்ன மண்டபம் மாதிரி தென்பட, அது என்ன என்று ஒருவரிடம் விசாரிக்க, இங்கிருந்துதான் ஸ்ரீராமர் வனவாசம் சென்றார் என்றார்கள்.

நாங்கள் சென்ற ஆட்டோ டிரைவரிடம் “ராம ஜென்ம பூமியை பார்த்துவிடலாம். மற்றவை எல்லாம் பிறகு” என்றோம். போகும் வழியில் ஒரு இடத்தில் ஆட்டோவின் வேகத்தைக் குறைத்து ராமர் கோயில் கட்டுவதற்குத் தயாராக இருக்கும் தூண், கற்கள் முதலியவற்றைக் காண்பித்தார்.

ராம ஜன்ம பூமி வாயிலை அடைந்தபோது அங்கே camouflage உடையில் தூப்பாகியுடன் ராணுவத்தைப் பார்க்க பயமாகத்தான் இருந்தது. கையில் இருந்த பை, பேனா, மொபைல் என்று சகல வஸ்துக்களையும் ஒரு கடையில் கொடுத்துவிட்டு உள்ளே நுழைந்தோம்.

என் பர்ஸை முழுவதும் சோசித்த முதல் காவலாளி, “ஏதாவது சிம் கார்ட் இருக்கா?” என்றார். “சின்ன சீப்பு மட்டும்தான் இருக்கு” என்றேன். அதை வாங்கிப் பக்கத்தில் இருந்த குப்பைத் தொட்டியில் போட்டார்.

இருபது அடியில் மீண்டும் சோதனை. இந்த முறை அவர் என் பர்ஸை முழுவதும் சோதித்துப் பார்த்து என் இடுப்பில் இருந்த அங்கவஸ்திரத்தைத் தடவியபின் உள்ளே அனுமதித்தார்.

இதற்கு பிறகு சர்க்கஸ் கூண்டுக்குள் போகும் சிங்கம் போலச் சென்றேன். என்னுடன் வந்தவர் கொஞ்சம் எரிச்சலாக “எதுக்கு இவ்வளவு செக்யூரிட்டி செக்” என்று சொல்லி முடிக்கும் முன் அடுத்த செ.செக். அங்கவஸ்திரம் கழற்றப்பட்டது.

இடுப்பில் கட்டிக்கொண்டபின் மேலும் ஒரு செ.செக். மனதில் இருந்த ராமரைத் தவிர மற்ற எல்லாவற்றையும் சோதித்துவிட்டார்கள். போர்ட்டிங் பாஸ் கொடுத்து வைகுண்டத்துக்கு அனுப்பினாலும் ஆச்சரியபட்டிருக்க மாட்டேன்.

கூண்டுக்குள் நடக்கும்போது வெளியே சிஆர்பிஎப் வீரர்கள் கையில் AK47 வைத்துக்கொண்டு சோர்வே இல்லாமல் காவல் காத்துக்கொண்டு இருப்பதைப் பார்க்க முடிந்தது.

சில நிமிஷத்தில் ராம ஜன்ம பூமி என்ற பிரசித்தி பெற்ற இடம் வந்தது. தற்போது உள்ள கோயில், இரண்டு சுவற்றின் மீது தார்பாலின் கூடாரம். ‘மனத்துக்கு இனியான்’ என்று ஆண்டாள் போற்றிய சக்ரவர்த்தித் திருமகனான ஸ்ரீராமரை ஒருவித கனத்த மனத்துடன் பார்த்துக்கொண்டு இருந்தேன்.

சென்ற ஆண்டு மதுராவுக்குச் சென்றபோதும் இதே நிலைமை. எல்லாம் பெருமாள் திருவுள்ளம் என்று நினைத்துக்கொண்டேன்.

இக்ஷ்வாகு வம்சத்தில் உதித்த ஸ்ரீராமர், தான் ஆராதித்த ஸ்ரீரங்கநாதரை விபீஷ்ணனிடம் அன்பளிப்பாகக் கொடுத்தார் அதுவே இன்று ஸ்ரீரங்கத்தில் இருக்கும் பெருமாள். வைகுண்டத்தின் ஒரு பகுதி அயோத்தியா என்பார்கள். ராமர் ஆராதித்த பெருமாள், விமானம் ஸ்ரீரங்கம் வந்தபோது ஸ்ரீரங்கம் பூலோக வைகுண்டம் ஆனதில் வியப்பில்லை.

சங்க இலக்கியங்கள், வால்மீகி, ஆழ்வார்கள், கம்பன் எல்லோரும் அயோத்தி பற்றிக் குறிப்பிடுகிறார்கள். கட்டுரையின் ஆரம்பத்தில் சொல்லப்பட்டிருப்பது போல, ‘நம்பப்படுகிறது’ என்று சொல்லுவது அயோக்கியத்தனம். ஸ்ரீராமர் இங்குதான் பிறந்தார் என்று நம் குழந்தைகளுக்குச் சொல்லித்தர வேண்டும். மாற்றக் கூடாதவற்றை மாற்றாமல் இருப்பதுதான் முன்னேற்றம்.

ஸ்ரீராமரை சேவித்துவிட்டு அவர்கள் கொடுத்த கற்கண்டு பிரசாதத்தை எடுத்துக்கொண்டு நடக்கும் போது மனம் முழுவதும் ஸ்ரீராமரே குடிகொண்டு இருந்தார். சீக்கிரம் இங்கே கோயில் கட்டப்பட்டு அதில் ஸ்ரீராமரைச் சேவிக்க வேண்டும் என்று நினைத்துக்கொண்டேன்.

அயோத்தியா – தயார் நிலையில்
அங்கே இருந்த ஒரு ஜவானிடம் பேச்சுக் கொடுத்தோம் (நல்ல வேளை என் நண்பருக்கு ஹிந்தி தெரியும்!)

சம்பாஷனை இதுதான்.

“இங்கே தான் பாப்ரி மஸ்ஜித் இருந்ததா?” என்று கேட்டோம். அதற்கு அந்த ஜவான், “நீங்களே மஸ்ஜித் என்று சொல்லலாமா? இங்கே ராமர் கோயில்தான் இருந்தது, மஸ்ஜித் இல்லை… இது ராமருக்கே சொந்தமான இடம்…”

உணர்ச்சிவசப்பட்டு “ஜெய் ஸ்ரீராம்!” என்றேன்

கொஞ்சம் தூரம் நடந்தபின் மேலும் இன்னொரு ஜவானிடம் பேச்சுக் கொடுத்தோம்.

“எவ்வளவு நாளா இங்கே காவல் புரிகிறீர்கள்?”

“இங்கே ராமர் கோயில் வரும் வரை நாங்கள் காவல் காப்போம்… கோர்ட் கோயில் கட்டலாம் என்றால் நான்கே மணி நேரத்தில் கோயில் கட்டி முடித்துவிடுவோம்!”

மீண்டும் “ஜெய் ஸ்ரீராம்” என்றோம். ஜவான்கள் சல்யூட் அடிக்க, உணர்ச்சிவசப்பட்டுத் திரும்பினேன்.

அயோத்தியா பற்றிய செய்திகள், படங்கள், புத்தகங்களை கூகிளில் பார்க்கலாம். ஆனால் நேரில் பார்க்கும்போது இங்கே ஸ்ரீராம ஸ்பரிசம் ஏற்படுவது நிச்சயம். எங்கு திரும்பினாலும் ஸ்ரீராம பஜனைகள். கோயில்களில் தாடி வைத்த பெரியவர்கள் ஸ்ரீராமாயணத்தை சதா படித்துக்கொண்டே இருக்கிறார்கள். எங்கு திரும்பினாலும் வானரக்கூட்டம். வீடுகள் இருக்கிறதா, இல்லை எல்லாம் கோயிலா என்று பிரமிப்பே ஏற்படுகிறது.
*
ஸ்ரீரமரை சேவித்துவிட்டு ‘அம்மாஜி மந்திர்’ என்று பிரசித்தி பெற்ற கோயிலுக்குப் பயணம் ஆனேன். இந்த கோயில் சுமார் 700 ஆண்டுகள் பழமை வாய்ந்தது. கோயிலைப் பார்த்தவுடன் நம் மனதில் ‘ரகுவம்ச சுதா’வின் கதன குதூகலம் ஏற்படுகிறது. காரணம் கோயில் தென்னாட்டுப் பாணியில் அமைந்துள்ளது. கோயிலின் உள்ளே சீதை ராமர், லட்சுமணருடன் காட்சி தருகிறார்கள். கூடவே ஹனுமார். தனி சன்னதியில் சின்னதாக ஆனால் மிக அழகாக ஸ்ரீரங்கநாதர் சேவை. எதிரே ஆழ்வார்களுடன் ஸ்ரீராமானுஜர் எழுந்தருளியிருக்கிறார்.

கோயிலுக்கு வெளியே வரும் போது தம்பதிகள் படம் ஒன்று கண்ணில் தென்பட அது யார் என்று விசாரித்தேன். யோகி பார்த்தசாரதி, அவர் தர்மபத்தினி யோகினி சிங்கம்மாள்.

யோகி பார்த்தசாரதி, அவர் தர்மபத்தினி யோகினி சிங்கம்மாள்
 இவர்களுக்கும் இந்த கோயிலுக்கும் என்ன சம்பந்தம்? இவர்கள் கனவில் ஸ்ரீராமர் தோன்றி திருப்புள்ளாணியில் ஒரு குறிப்பிட்ட இடத்தில் அர்ச்சா மூர்த்தியாக இருக்கிறேன், அதை அயோத்தியில் பிரதிஷ்டை செய்ய வேண்டும் என்று பணிக்க, ராமேஸ்ரத்துக்குப் பயணித்தார்கள். குறிப்பிட்ட இடத்தில் ஸ்ரீராமர், சீதை, லட்சுமணன் ஆகிய மூவரின் அர்ச்சா மூர்த்தி கிடைக்க, அதை பிரதிஷ்டை செய்ய அயோத்தியில் நிலத்தை வாங்கிக் கோயிலை ஏற்படுத்தினார்கள்.

1900ல் யோகி பாரத்தசாரதி ஆசாரியன் திருவடியை அடைந்த பிறகு நாற்பது வருட காலம் அவர் தர்மபத்தினி சிங்கம்மாள் கைங்கரியங்களைப் பார்த்துக்கொண்டாள். அதனால் இந்தக் கோயில் ‘அம்மாஜி’ மந்திர் என்று அழைக்கப்படுகிறது.

கோயிலில் தமிழில் நாலாயிரத் திவ்ய பிரபந்தங்கள் பேனர் கண்ணில் பட்டது. அயோத்தியா பற்றி ஆழ்வார்களின் மங்களாசாசன பாசுரங்கள். சேவித்தேன்.

தென் திசையிலிருந்து வட திசைக்கு பிரபந்தம் வந்துள்ளது. அதற்கு காரணம் ஸ்ரீராமர்தான். ஸ்ரீராமர் அருள் இல்லை என்றால் நமக்கு நம்மாழ்வாரே கிடைத்திருக்க மாட்டார்.

மதுரகவிகள் அயோத்தியில் இருந்தபோதுதான் வானத்தில் ஒரு ஒளி தென்பட்டது. அதைத் தேடிக்கொண்டு சென்று திருக்குறுகூர் என்ற அழ்வார் திருநகரிக்கு வந்தடைந்து நம்மாழ்வாரைப் புளியமரத்துப் பொந்தில் பார்த்து அவருக்கு சிஷ்யரானார். திருவாய்மொழி நமக்குக் கிடைத்தது. இது அயோத்தியின் பெருமை!

அடுத்து வசிஷ்ட் குண்ட் என்ற அழகான கோயில். ராமர் மற்றும் அவருடைய சகோதரரர்கள் பயின்ற இடம். குருவிடம் நால்வரும் படிக்கும் சிற்பம் அழகாகவும் மனதுக்கு நிறைவாகவும் இருக்கிறது. அங்கே ஒரு கிணறு இருந்தது. “வாங்க அதை காண்பிக்கிறேன்” என்று ஒருவர் எங்களை கீழ்ப்பகுதிக்கு அழைத்துச் சென்றார். கிணறு சின்ன குளம் போலக் காட்சி அளித்தது! “சரயூ நதியில் என்ன அளவு தண்ணீர் இருக்குமோ அதே அளவு இங்கே இருக்கும்” என்று எங்களை ஆச்சரியப்படுத்தினார். அதில் சின்னதாக ஒரு ஆமை நீச்சல் அடித்துக்கொண்டு இருந்தது.

*
பிரியாவிடை கொடுத்துவிட்டு ஹனுமான் கடீ என்ற இடத்துக்குச் சென்றேன். சிறு குன்றின் மீது அமர்ந்திருக்கும் ஹனுமானுக்கு நாமே லட்டுவைச் சமர்பித்துவிட்டு வரலாம். இந்த ஹனுமான்தான் அயோத்தியை இன்றும் காத்துக்கொண்டு இருக்கிறார். அதனால் ரொம்ப பவர் ஃபுல் அனுமார்.

அயோத்தி முழுக்க குரங்குகளைப் பார்க்க முடிகிறது. அவைகளை யாரும் ஒரு சங்கடமாக நினைப்பதில்லை. குப்தார் காட் என்ற சரயூ நதிக்கரையில் (அயோத்தியிலிருந்து 15 கிமீ தூரம்) ஸ்ரீராமன் வைகுண்டத்துக்கு எல்லோரையும் அழைத்துச் சென்ற இடம். எல்லோரும் என்றால் நாட்டு மக்கள், புல், கல் என்று எல்லாவற்றையும், ஒருவரைத் தவிர. அது ஹனுமான். ராம நாமம் சொல்லிக்கொண்டு இங்கேயே அயோத்தியில் இருக்கிறேன் என்று சொல்லிவிட்டார். அதனால்தான் அயோத்தியா இன்றும் இருக்கிறது.

பிருந்தாவனம் போல அயோத்தியில் குரங்குகள் சேட்டை செய்வதில்லை. கண்ணன் கோபிகைகளின் துணியை ஒளித்துவைப்பது போல பிருந்தாவனத்தில் குரங்குகள் நம் மூக்குக் கண்ணாடியைப் பிடுங்கி வைத்துக்கொள்ளும் விளையாட்டு கிடையாது.

பாபர் மசூதிக்குள் 1949ல் இந்து பக்தர்களின் வழிபாட்டுக்குத் திறந்து விடும் உத்திரவை 1986ல் பிறப்பித்த பைசலாபாத் மாவட்ட நீதிபதி கே.எம்.பாண்டே, பதவியிலிருந்து ஓய்வு பெற்றபின், 1991ல் தனது சுய சரிதையில் இவ்வாறு குறிப்பிட்டுள்ளார்.

“பூட்டியிருந்த கோயிலின் கதவை பக்தர்களின் தரிசனத்துக்குத் திறந்து விடுவதற்கான உத்திரவைப் பிறப்பித்த அந்த நாளன்று, எனது நீதிமன்ற அறையின் மேற்கூரையில் கொடிமரத்தைப் பற்றியபடி ஒரு கருப்புக் குரங்கு அமர்ந்திருந்தது. அன்றைய தினம் தீர்ப்பு என்ன என்பதைத் தெரிந்து கொள்வதற்காக நீதிமன்ற வளாகத்தில் கூடியிருந்த பைசலாபாத், அயோத்தி நகரங்களைச் சேர்ந்த ஆயிரக்கணக்கான மக்கள் அந்தக் குரங்குக்கு வேர்க்கடலை, பழம் முதலானவற்றைக் கொடுத்தனர். அந்தக் குரங்கோ அவற்றைத் தொடக்கூட இல்லை. மாலை 4.40க்கு நான் தீர்ப்பைப் படித்தவுடன் அந்தக் குரங்கு அங்கிருந்து அகன்றது. பின்னர் எனது பாதுகாப்புக்காக வந்திருந்த மாவட்ட ஆட்சியரும், போலிஸ் கண்காணிப்பாளரும் என்னை எனது பங்களாவுக்கு அழைத்துச் சென்றனர். பார்த்தால், எனது பங்களாவின் தாழ்வாரத்தில் அமர்ந்திருக்கிறது அந்தக் குரங்கு. எனக்கு அச்சரியம் தாங்கமுடியவில்லை. நிச்சயமாக ஒரு தெய்வீக சக்திதான் அந்தக் குரங்கு என்பதை உணர்ந்துகொண்டு அதனை வணங்கினேன்.”

*
மதிய உணவு சமயம் சாப்பாட்டைத் தவிர்த்து மீண்டும் ராம ஜன்ம பூமிக்குப் பயணித்தேன். இந்த முறையும் என்னை முழுவதும் சோதித்து அனுப்பினார்கள். என் சீப்பை போட்ட அந்த குப்பைத் தொட்டியில் எட்டி பார்த்தேன். நீங்கள் நம்ப மாட்டீர்கள், உள்ளே பல சீப்புக்கள்!

மீண்டும் மனத்துக்கு இனியானை சற்று நேரம் சேவித்துவிட்டு அடுத்தமுறை வரும்போது கோயில் கட்டியிருக்க வேண்டும் என்று ஸ்ரீராமரிடம் ஆத்மார்த்தமாகப் பிராத்தனை செய்துகொண்டேன்.

மாலை நாட்டிய நிகழ்ச்சி. கூடவே ஸ்ரீராமர் பட்டாபிஷேகம் நடந்தது. அந்த நிகழ்வின்போது உ.வே ஸ்ரீவேளுக்குடி ஸ்வாமி குழுமியிருந்த 1,500 பேரிடமும் ஒரு பிரார்த்தனை வைத்தார். அது, “விரைவில் பல ஆயிரம் பேர் ஒரே இடத்திலிருந்து பஜனை செய்யும் வசதியுடன் ஸ்ரீராமருக்குக் கோயில் ஒன்று அமைய வேண்டும்” என்பதுதான். நிச்சயம் இந்தப் பிரார்த்தனை பலிக்கும்.

*
மறுநாள் குப்தார் காட் நதிக்கரையில் நீராடிவிட்டு, அயோத்தியின் பெருமையை முழுவதும் சொல்ல முடியாமல் ‘யாது என் வியப்பாம்’ என்று கம்பன் சொல்லியது நிஜம் என்று நினைத்துக்கொண்டு கிளம்பினேன்.

பிள்ளைப் பெருமாள் ஐயங்காரின் நூற்றெட்டுத் திருப்பதி அந்தாதியில் அயோத்தியா பற்றி இப்படிக் குறிப்பிடுகிறார்.

ஆர்க்கும் இது நன்று தீது ஆனாலும் நெஞ்சே நீ
பார்க்கும் பல கலையும் பன்னாதே சீர்க்கும்
திரு ஐ யோதிப் புயலை சீரிய மெய்ஞ்ஞானத்து
உருவை ஒத்தின் பொருளை ஓர்

அயோத்தி ஸ்ரீராமரை தியானித்தால் போதும், வேறு எதுவும் செய்ய வேண்டாம் என்பது ஒருவரி அர்த்தம்.


யோக ஆசான் ஸ்ரீ கிருஷ்ணமாச்சார்யா – சுஜாதா தேசிகன்


ஸ்ரீ கிருஷ்ணமாச்சாரியரிடம் கேட்கப்பட்ட, ‘இந்தச் சமுதாயத்துக்கு உங்களது செய்தி என்ன?’ என்ற கேள்விக்கு அவர் அளித்த பதில் – ஓம்!

முன்பு ‘மாரல் சைன்ஸ்’ என்றொரு வகுப்பு இருந்தது. அதில் பெரும்பாலும் ஆசிரியர், “சத்தம் போடாமல் ஏதாவது செய்யுங்க” என்ற அறிவுரையுடன் நோட்டுப் புத்தகங்களைத் திருத்திக்கொண்டு இருப்பார். எப்பொழுதாவது நீதிக் கதைகள் சொல்லுவார். மற்றபடி அது ‘ஓபி’ வகுப்பு. மூக்குக்குக் கீழே மீசை எட்டிப்பார்க்கும் காலத்தில் அறிவியல் பாடம் ஃபிஸிக்ஸ், கெமிஸ்டரி, பையாலஜி என்று பிரிக்கப்பட்டு, ‘மாரல் சைன்ஸ்’ மறைந்து போனது.

ஹார்மோன்களின் அட்டகாசத்தால் பல சிக்கல்கள் வரும் பருவத்தில் ‘மாரல் சைன்ஸ்’ வகுப்பைப் புறக்கணித்துவிட்டு, எல்லோரும் என்ஜினியர்களாகவோ அல்லது டாக்டராகவோ புறப்படுகிறார்கள்.

இன்றைய காலகட்டத்தில் மாரல் சைன்ஸ் என்ற வகுப்பு ‘வேல்யூ எஜுகேஷன்’ என்று உருமாறி, லீடர் ஷிப், கம்யூனிகேஷன், கமிட்மெண்ட், ரெலேஷன்ஷிப், பர்சனாலிட்டி டெவலப்மென்ட் என்று கார்பரேட் சமாசாரமாகிவிட்டது.

பத்து வயதுப் பையன் ஒருவனுக்கு ‘மௌஸ்’ உபயோகிக்க முடிகிறது என்பது விஞ்ஞானம் இல்லை, ‘வீண்’ஞானம். இந்த வயதில் அறிவியலுடன் தேவை ‘மாரல் சைன்ஸ்’. நம் பாரத தேசத்தில் ஸ்ரீராமாயணம், ஸ்ரீமஹாபாரதம் போன்ற காப்பியங்களையும், தென்திசை முதல் வடதிசை வரை உள்ள மஹான்களின் சரித்திரங்களையும் சொல்லிக்கொடுக்க வேண்டும். இதுவே அவனுக்குச் சிறந்த மருந்தாக அமையும்.

நச்சுப் பொருள் நம் உடலுக்குத் தீங்கு விளைவிக்கும் என்பது நம் எல்லோருக்கும் தெரியும். விஷம் மட்டும் நச்சு என்று என்று நினைக்கவேண்டாம். கடையில் வாங்கும் சீரியல் (Cereal, தானியம்) முதல் டிவியில் பார்க்கும் சீரியல் வரை எல்லாமே நச்சுத்தன்மை உடையவை. டிவி சீரியலா என்று உங்கள் மனது கேட்கிறது அல்லவா? அதற்குக் காரணம் உடலையும் மனதையும் நாம் பிரித்து பார்ப்பதால்தான்.

இன்று இருக்கும் டயபட்டீஸ் (நீரிழிவு), ஹைப்பர் டென்ஷன், உடல் பருமன், அல்சைமர் போன்ற கோளாறுகளுக்கும் மனதிற்கும் சம்பந்தம் உண்டு. இதற்கு மருந்து மாத்திரைகள் கிடையாது. உணவுக் கட்டுப்பாடும் யோகாவும்தான் சிறந்த வழி.

“எதுக்கும் நீங்க யோகா ட்ரை பண்ணுங்க” என்ற அறிவுரை, மன அழுத்தம், முதுகு, முழங்கால் வலி வந்தால் மட்டுமே பரிந்துரைக்கப்படுகிறது. யோகாவை ஏதோ ‘ஜிம்மிக்கி கம்மல்’ ரேஞ்சுக்கு பாட்டு போட்டு ஆடுவது எல்லாம் பாவம்.

இருபதாம் நூற்றாண்டின் யோகாச்சார்யா ஸ்ரீ கிருஷ்ணமாச்சார்யா அவர்களின் வாழ்க்கை வரலாற்றுப் புத்தகம் (தமிழில்) வாங்கி, படிக்காமல் பில்லுடன் வைத்திருந்தேன். பெரிய யோகி என்று அப்பா இவரைப் பற்றிச் சொல்லியிருக்கிறார். புத்தகத்தைப் படிக்கும் வாய்ப்பு சில வாரங்கள் முன் கிடைத்தது. முன்பே படித்திருக்கலாமே என்று வருத்தப்பட வைத்த புத்தகம்.

யோகா கற்றுக்கொள் என்று என் அப்பா என்னிடம் சொல்லியிருக்கிறார். மாடிக்கு அழைத்துச் சென்று என் அப்பா எனக்குப் பல ஆசனங்களைச் செய்து காண்பித்தது இன்றும் நினைவிருக்கிறது. கோலிக்குண்டு அளவு இருந்த சிறுநீரகக் கல்லை, ஆபரேஷன் செய்துக்கொள்ளாமல் தினமும் வாழைத்தண்டு சாறு குடித்தும் யோகாசனம் செய்தும் வெளியே கொண்டுவந்து டாக்டரையும் எங்களையும் ஆச்சரியப்படுத்தினார்.

நான் படித்த ஸ்ரீ கிருஷ்ணமாச்சாரியார் வாழ்க்கைக் குறிப்பை உங்களுடன் பகிர்ந்து கொள்ளுமுன் சுருக்கமாகச் சில ஸ்ரீவைஷ்ணவ ஆசாரியர்கள் பற்றிச் சொல்கிறேன். அப்போதுதான் ஸ்ரீ கிருஷ்ணமாச்சாரியாரின் வாழ்கை வரலாறு எவ்வளவு மதிப்பு மிக்கது என்று நமக்குத் தெரியும்.

நாதமுனிகள் நாலாயிர திவ்யப் பிரபந்தத்தை நம்மாழ்வாரிடமிருந்து பெற்றுத் தந்தவர். ‘கண்ணிநுண் சிறுத்தாம்பு’ என்ற 11 பாசுரங்களை ஆழ்வார் திருநகரியில் உள்ள புளியமரத்துக்கு அடியில் ஆஷ்டாங்க யோகத்தில் நம்மாழ்வாரைத் தியானித்துப் பெற்றார்.

நாதமுனிகள் அருளிச் செய்தவற்றுள் யோக ரஹஸ்யம் அடங்கும். அதை குருகைக் காவலப்பன் என்ற தன்னுடைய சிஷ்யருக்குச் சொல்லிக் கொடுத்தார். அவர் காலத்துக்குப் பிறகு, அதை தன் பேரனான ஆளவந்தாரிடம் சொல்லித் தரும்படி நியமித்தார்.

ஆளவந்தார் யோக ரஹஸ்யத்தை கற்றுக்கொள்ள குருகைக் காவலப்பன் தியானிக்கும் இடம் வந்தடைந்த போது, குருகைக் காவலப்பன் தியானத்தில் இருந்தார். அவரைத் தொந்தரவு செய்ய விரும்பாமல், ஒரு மதிலின் பின் மறைந்து அவர் முடிக்கும் வரை காத்துக்கொண்டிருக்க, திடீர் என்று குருகைக் காவலப்பன் கண் விழித்து “இங்கே சொட்டை குலத்தைச் சேர்ந்தவர் யார்?” என்று கேட்க, ஆளவந்தார் வெளிப்பட்டு தன்னை நாதமுனிகளின் பேரன் என்று அறிமுகம் செய்து கொண்டார். (நாதமுனிகள் சொட்டை குலத்தைச் சேர்ந்தவர்.)

ஆளவந்தார் ஆச்சரியப்பட்டு “எப்படிக் கண்டுபிடித்தீர்கள்?” என்று கேட்க, “யோகத்தில் இருந்தபோது பெருமாள் தன் தோளை அழுத்தி எட்டிப்பார்த்தார், சரி, நாதமுனிகளின் சொட்டை குலத்திலிருந்து ஒருவர் வந்துள்ளார் என்பதை யூகித்தேன்” என்றார். ஆனால் ஆளவந்தாருக்கு யோக ரஹஸ்யம் கிடைக்கவில்லை. பிறகு அது அழிந்து போயிற்று. ஆளவந்தார் காலம் பொ.பி. 976 – 1006.

ஆளவந்தாருக்குப் பிறகு 800 ஆண்டுகளுக்குப்பின் 1888ம் வருடம் நவம்பர் மாதம் 18ம் நாள் கர்நாடகாவில் உள்ள சித்ரதுர்கா மாவட்டத்தில் பிறந்தார் ஸ்ரீ கிருஷ்ணமாச்சாரியார். இவர் நாதமுனிகள் வம்சத்தவர். அவரது வாழ்க்கை வரலாற்று நூலின் முன்னுரையில் அவரது மகன் டி.கே.வி. தேசிகாச்சார் இப்படி எழுதுகிறார்.

“எங்கள் குரு ஸ்ரீ கிருஷ்ணமாச்சார்யா நூறு வருடங்கள் மேல் வாழ்ந்தும், தன் வாழ்க்கை வரலாறு பற்றிச் சில தகவல்களே விட்டுச் சென்றுள்ளார். பல துறைகளில் நிபுணராக இருந்த இவருடைய பின்னணி எல்லோருடைய ஆர்வத்தையும் தூண்டும். பல முறை முயற்சி செய்தும் இவரைப்பற்றி செய்தி அதிக அளவில் சேர்க்க முடியவில்லை. பல முறைகள் வற்புறுத்தியபின் ஒரிரு முறைகள், தன் வாழ்க்கையில் முக்கியமான சில நிகழ்ச்சிகளைச் சொன்னார். இதுவும் சுவாரஸ்யமாக தொடரும்பொழுது, ‘இது அஹங்காரத்தைத் தூண்டும் பயணம்’ என்று சொல்வதை நிறுத்திவிடுவார்.”

இளம் வயதில் வேதத்தை சந்தை முறையில் தன் தந்தையிடம் கற்றார். இவருக்குப் பத்து வயது இருக்கும்போது துரதிர்ஷ்டவசமாக தந்தையை இழந்தார். பாட்டனார் மைசூரில் இருக்க, 12 வயதில் அங்கே சென்று பரகால மடத்தில் மாணவராகச் சேர்ந்தார். 16ம் வயதில் அந்த அதிசயம் நிகழ்ந்தது. கனவில் நாதமுனிகள் தோன்றி தெற்கே உள்ள அழ்வார் திருநகரிக்கு வருமாறு கட்டளையிட்டார். பணத்தைச் சேர்த்துக்கொண்டு ஆழ்வார் திருநகரிக்குப் புறப்பட்டார். .

ஆழ்வார் திருநகரியில் புளியமரத்தடியில் ஒரு பெரியவரை அணுகி “நாதமுனிகளை எங்கு தரிசிக்கலாம்?” என்று கேட்க, அவர் தனது கையால் காட்டிய திசையை நோக்கிச் சென்றார். அது தாமிரபரணி நதிக்கரையில் ஒரு மாமரத்தடி. உணவருந்தாமல் மிகவும் களைத்திருந்த இவர் அங்கு மயக்கமாக விழுந்தார். அங்கு இவருக்கு ஓர் அனுபவம் ஏற்பட்டது. மூன்று மாமுனிவர்கள் மத்தியில் அவர் இருந்தார். அவர்களை நமஸ்கரித்து, நாதமுனிகள் இயற்றிய யோக ரஹஸ்யத்தைத் தனக்கு போதிக்கும்படியாகக் கேட்டுக்கொண்டர். நடுவில் இருந்த நாதமுனிகள் தனது இனிமையான குரலில் யோக ரஹஸ்யத்தை செய்யுளாகக் கூற, அதைக் கேட்டுக்கொண்டார். சில மணி நேரம் சென்று ஸ்ரீ கிருஷ்ணமாச்சாரியார் தன் சுயநினைவு வந்தபோது முனிவர்கள் மறைந்தனர். மாமரத்தடியையும் காணவில்லை.

மீண்டும் கோயிலுக்குத் திரும்பினார். அங்கு அந்தப் பெரியவர் இவரைப் பார்த்தவுடன் “என்ன, நாதமுனிகளிடமிருந்து யோக ரஹஸ்யம் உபதேசமாயிற்றா? கோயிலுக்குப் போய்ப் பெருமாளைச் சேவி” என்று கூற, கோயிலுக்குச் சென்று திரும்பி வந்ததும் அந்தப் பெரியவரையும் காணவில்லை. அப்போதுதான் அந்தப் பெரியவர் தனது கனவில் தோன்றிய, மூன்று மாமுனிவர்கள் நடுவில் காட்சி தந்த நாதமுனிகள் தோற்றமாய் இருந்தது தெரிந்தது.

இவ்வகையில், காலத்தால் அழிந்திருந்த ‘யோக ரஹஸ்யம்’ என்ற அரிய நூல் இவருக்குக் கிடைத்தது. இதன் அடிப்படையில்தான் தன் யோக தத்துவங்களை வகுத்துக்கொண்டார். மீண்டும் மைசூர் திரும்பி மேலும் படித்து ‘வித்வானாக’ தேறி, சம்ஸ்கிருத மேற்படிப்புக்கு வாரணாசிக்கு தன் 18ம் வயதில் புறப்பட்டார். அங்கும் ஓர் ஆச்சரியம் நடந்தது.

அங்கே சிவகுமார சாஸ்திரியிடம் மாணவரானார். ஒரே இரவில் தனது குருவிடமிருந்து சம்ஸ்கிருத மொழியிலிருந்து நுண்ணிய அரிய விஷயங்களைக் கேட்டறிந்தார். மறுநாள், இவரது குரு தன் பேசும் சக்தியை இழந்தார்! இவருக்காகக் காத்துக்கொண்டு இருந்தது போல இருந்தது இச்சம்பவம். மூன்று ஆண்டுகளுக்குப் பிறகு மீண்டும் மைசூர் வந்த பிறகு வீணை, மீமாம்ஸம், பகவத் கீதை, ஸ்ரீவேதாந்த தேசிகரின் ரஹஸ்யத்ரயசாரம், ஸ்ரீராமானுஜரின் ஸ்ரீபாஷ்யம், ஆகியவற்றைக் கற்றார்.

காசி அவரைக் கவர்ந்திழுத்தது, மீண்டும் கற்க வாரணாசி பயணமானார்.

உஞ்சவிருத்தி எடுத்துப் பெற்ற மாவிலிருந்து தேவையான ரொட்டியைச் செய்துகொண்டு படித்து, படிப்பில் சிறந்து விளங்கிப் பல பட்டங்களைப் பெற்றார். ஒவ்வொரு கோடை விடுமுறையிலும் (மூன்று மாதங்கள்) இமய மலைச்சாரலுக்கு அருகில் உள்ள கோயில்களுக்கும் புண்ணியத் தலங்களுக்கும் சென்று வருவார். மலைப்பிரதேசத்தில் நெடுந்தூரம் ஏறிச்செல்வதிலும் இயற்கையைக் கண்டு களிப்பதிலும் தன் பொழுதைப் போக்குவார். இவரது பூகோள அறிவு வியக்கத்தக்கது. ஒருவன் நிறைய இடங்கள் செல்வதின் மூலமே நல்ல அறிவைப் பெறுகிறான் என்று வலியுறுத்துவார்.

வாரணாசியில் படிக்கும்போது தந்தையாரிடம் கற்றிருந்த ஆசனப் ப்ராணாயாமங்களைச் செய்து வந்தார். இதைக் கவனித்து வந்த ஒரு சாது இவரை யோக நிபுணர் ஸ்ரீபாபு பகவன் தாஸிடம் அனுப்பினார். அவர் இவரை பாட்னா பல்கலைக்கழகத்தில் மணவனாக அனுமதித்தார்.

பாட்னா பல்கலைக்கழகத்தில் இவரது யோகா ஆசிரியர் ஸ்ரீ கங்காநாத்ஜா என்பவர் ‘யோகாச்சார்யா’ பட்டம் பெற்றவர். அவரிடம் யோகா பயின்று அதில் மேலும் தேர்ச்சி பெற விருப்பம் தெரிவித்தார்.

அதற்கு அவர் “யோகத்தை முறையே பயில வேண்டுமானால் நேபாளம் தாண்டி திபெத்தில் யோகிவர்யர் ஸ்ரீ ராமமோஹன ப்ரம்மச்சாரியிடம் கற்றுக்கொள்ள வேண்டும்” என்று சொல்ல ஸ்ரீ கிருஷ்ணமாச்சார்யார் தனது குறிக்கோளை அடைய முடிவு செய்தார்.

அந்தக் காலத்தில் நாடுவிட்டு வெளியே செல்வது அவ்வளவு எளிதல்ல. சிம்லாவில் இருந்த வைஸ்ராயிடம் இவரது ஆசிரியர் சிபாரிசுக் கடிதம் கொடுத்தார். துரதிஷ்டவசமாக வைஸ்ராய் சர்க்கரை வியாதியால் உடல்நலம் குன்றி இருந்தார்.

ஒருநாள் வைஸ்ராயிடமிருந்து அழைப்பு வர, அவருக்கு ஆறு மாதம் யோகப் பயிற்சி அளிக்க, சர்க்கரை நோய் கட்டுக்குள் வந்தது. வைஸ்ராய் சந்தோஷமாக இவர் ஹிமாலயத்தைக் கடந்து இந்தியாவுக்கு வெளியே நோபாளம் திபெத் செல்ல உதவி செய்தார். ஆனால் மூன்று மாதத்துக்கு ஒருமுறை சிம்லா வந்து இவருக்கு யோகா கற்றுக்கொடுக்க வேண்டும் என்ற நிபந்தனையும் இட்டார்.

கிட்டத்தட்ட ஒரு மாதம் நடந்தே  மானஸரோவர் சென்று ஸ்ரீ ராமமோஹன ப்ரம்மச்சாரியைத் தேடி, ஒரு குகையில் அவரைக் கண்டுபிடித்தார். வணங்கி சீடனாக ஏற்றுக்கொள்ளும்படி வேண்டினார். சில நாளில் ஸ்ரீராம மோஹன ப்ரம்மச்சாரியின் குடும்பத்தில் ஒருவரானார். பதஞ்சலி யோக சூத்திரத்தில் விவரிக்கப்பட்ட பல யோக நிலைகளை நேபாள மொழியில் உள்ள யோக கூரண்டத்தைக் கொண்டு அறிந்துகொண்டார்.

முதல் மூன்று வருடங்கள் யோக சூத்திரம் கற்றார். அடுத்த மூன்று வருடங்கள் யோகாப்யாஸ்யம் செய்வதில் கழித்தார். அதை அடுத்து ஒன்றரை வருடங்கள் சிஷ்ண க்ரமம், சிகிச்சா க்ரமம் என்ற யோகாபியாசத்தை மொத்தம் ஏழரை வருடங்கள் கற்றார். நடுவில் மூன்று மாதத்துக்கு ஒரு முறை சிம்லா சென்று வைஸ்ராய்க்கு யோகா பயிற்சி அளித்தார்.

ஏழரை வருடங்கள் குருவுடன் தன் வாழ்க்கையை ஆனந்தமாகக் கழித்தார். அங்கேயே ஆனந்தமாக இருந்திருக்கலாம். ஆனால் இவர் குருவோ இவரை திரும்ப இந்தியா சென்று, குடும்ப வாழ்க்கை நடத்தி, யோக விஷயங்களை மக்கள் சேவைக்காக உபயோகப்படுத்துமாறு கட்டளையிட்டார்.

1922 திபெத்திலிருந்து திரும்பினார். மீண்டும் கல்கத்தா, அலகாபாத், பாட்னா, பரோடா ஆகிய பல்கலைக்கழங்களில் பல பட்டப்படிப்புகள் படித்தார். பிறகு மைசூர் ராஜகுடும்பத்தில் யோககுருவாக இருந்தார். அங்கே பலருக்கு நாடி பிடித்து உடல்நலக் குறைவானவர்களுக்கு உதவி செய்தார். இவர் ஆயுர்வேதத்திலும் மிகத் தேர்ச்சி பெற்றவர்.

ஸ்ரீகிருஷ்ணமாச்சரி ஆசனப்பயிற்சி முறையில், உடல், மூச்சு, மனது மூன்றும் சேர்ந்து இயங்கும். இவர் சொல்லிக்கொடுத்த முறை பதஞ்சலி யோக சூத்திரத்தில் கூறிய தத்துவங்களைத் தழுவியது.

ஸ்ரீ கிருஷ்ணமாச்சாரியாரின் யோகா முறை இது – உடலை ஆசனம் செய்வதன் மூலம் தயார் படுத்திக்கொள்ளவேண்டும். ஆசனம் செய்யும்போது உடலுடன் மனமும் மூச்சும் ஓரளவு கட்டுப்பாட்டில் கொண்டு வரப்படவேண்டும். பிறகு ப்ராணாயாமம் (மூச்சைக் கவனமாக கையாள்வது) செய்யவேண்டும். ப்ராணாயாமம் என்பது ஏதோ மூச்சை இழுத்து, அடக்கி விடுவது என்று நினைப்பார்கள். ஆனால் ஸ்ரீ கிருஷ்ணமாச்சாரியார் சொல்லிக்கொடுப்பது வேறு – மூச்சை உள்ளே இழுக்கும் போது உள்ளுக்குள் ஓர் அரிய சக்தி, நம்மைக் காக்கும் சக்தி போன்ற நிலை வர வேண்டும். அடக்கும்போது அந்த சக்தி நம்மைச் சுத்தம் செய்வதாக உணர வேண்டும். வெளிவிடும்போது மனதால் ‘எதுவும் என்னுடையது அல்ல, எல்லாம் உனக்கே சொந்தம்’ என்ற உணர்வுடன் வர வேண்டும். அடுத்த நிலை ஆசன ப்ராணாயாமம் செய்வது.

உடல் ஊனமுற்றோருக்கும் மன வளர்ச்சி குன்றியவர்களுக்கும் இவர் காட்டிய வழி மிக உயர்ந்தது. மனவளர்ச்சி குன்றியவர்களுக்கு மூளை செவ்வனே வேலை செய்ய பல வழிகளைக் கையாண்டார். இளம்பிள்ளைவாதத்தால் பாதிக்கப்பட்ட குழந்தைகளுக்காகச் சில கருவிகளை உருவாக்கினார்.

இவர் யோகத்தை ஒரு உடற்பயிற்சியாகக் கொள்ளாமல் கடவுளை அடையும் மார்க்கமாகக் கருதினார். மற்ற கலாசார, மதம் சம்பந்தப்பட்டவரகளுக்கு அவர்கள் கடைப்பிடிக்கும் புனிதமான பெயர்கள் இருந்தால் அதை உபயோகப்படுத்துங்கள் என்று சொல்லிவிடுவார். தன் நம்பிக்கையை ஒருபோதும் அவர்களிடம் திணிக்கமாட்டார்.

யோகாவில் மக்களை ஈர்க்க, யோகத்தால் இதயத் துடிப்பு, நாடி எல்லாவற்றையும் சில நிமிஷங்கள் நிறுத்தினார். இவரைப் பரிசோதித்த வெளிநாட்டு மருத்துவர்கள் ஆச்சரியப்பட்டனர் “I would have pronounced him dead” என்றார் ஒரு ஜெர்மானிய மருத்துவர். இந்த உத்தியைத் தனக்குச் சொல்லித் தரவேண்டும் என்று அவரது மகன் தேசிகாச்சார் கேட்க, “இது ஈகோவைத்தான் வளர்க்கும், இதனால் சமுதாயத்துக்கு ஓர் உபயோகமும் இல்லை” என்று மறுத்துவிட்டார்.

ஸ்ரீ கிருஷ்ணமாச்சாரியருக்கு நன்றாகச் சமைக்கத் தெரியும். கவிதை எழுதுவார், தோட்ட வேலை செய்வார். சங்கீதத்தைக் கேட்டுத் துல்லியமாக ராக, தாள தவறுகளைச் சுட்டிக் காட்டுவார். சங்கீத வித்வான்கள் இவரிடம் தங்கள் உடல் உபாதைகளுக்குத் தீர்வு கேட்கும்போது சங்கீத நுணுக்கங்களைக் கொண்டே தீர்வுகளை எடுத்துரைப்பார். வீட்டிலேயே ஆயூர்வேத மூலிகைகள் வளர்த்தார். நாட்டியத்தில் முன்னணியில் இருந்த பலர் இவரிடம் சந்தேகம் தீர்த்துக்கொள்வார்கள். ஜோதிடம் அவருக்குப் பிடித்த பிரிவு.

தனது அறையில் உள்ள நாற்காலி மேசைகளைக் காலத்துக்குத் தகுந்தவாறு மாற்றிப் போடுவது இவர் வழக்கம். ஒருமுறை முதல்நாள் மாற்றி போட்டது நினைவில்லாமல் அதிகாலை சூரிய உதயத்துக்குமுன் எழுந்து இருட்டில் நாற்காலி இல்லாத இடத்தில் நாற்காலி இருப்பதாக எண்ணி அமரப்போய், 1984ல் கீழே விழுந்து, இடுப்பு எலும்பு முறிந்தது. அப்போது அவருக்கு வயது 96! படுத்த படுக்கையான இவர் அறுவைசிகிச்சை செய்துகொள்ள மறுத்துவிட்டார். படுக்கையிலேயே தனக்குத்தானே மருத்துவம் பார்த்துக்கொண்டார். அதற்குத் தகுந்த ஆசனங்கள் செய்தார். இரண்டே மாதங்களில் இவர் எழுந்து உட்கார முடிந்தது. இதன் வீடியோ தொகுப்பை யூ ட்யூபில் காணலாம்.

கலிகாலத்தில் இறைவனை அடைய ‘சரணாகதி’ ஒன்றே வழி என்று திண்ணமாக நம்பினார். அதையே பலருக்கு உபதேசமும் செய்தார். 1988ல் நூறாவது வயதை அடைந்தார். விழாவை இறைவனுக்கு அர்ப்பணமாகச் செய்யுமாறு பணித்தார். அந்த விழாவின்போது, ஸ்ரீகிருஷ்ணமாச்சாரியார் ஓம் என்று மூச்சு விடாமல் 55நொடிகள் ஓதினார். அதைத் தவிர மூன்று மணி நேரம் சம்ஸ்கிருதத்தில் உரை நிகழ்த்தினார்.

யோகா உடலையும் மனதையும் பிரித்துப் பார்ப்பதில்லை. யோகா ஒரு வித உடற்பயிற்சி இல்லை. உடற்பயிற்சி செய்த பிறகு உடம்பு சோர்வாக வியர்த்துக்கொட்டும். ஆனால் யோகா செய்த பிறகு உடல் புத்துணர்ச்சி அடையும். கடவுளை நம் மனம் நினைக்க, உடல் ஒத்துழைக்க வேண்டும். உடல் மட்டும் ஒத்துழைத்தால் போதாது, மனதும் ஒத்துழைக்க யோகா உதவுகிறது.

பிரதமர் நரேந்திர மோதி 2015ல் யோகா நாள் அறிவித்து யோகா பற்றிய விழிப்புணர்வைக் கொண்டு வந்துள்ளது மிகவும் பாராட்டத்தக்க ஒன்று. யோகா நாதமுனிகள் காலத்திலேயே, ஏன் அதற்கு முன்பும் இருந்திருக்கக்கூடும். சில வருடங்கள்முன் யான்.ஓய் தயான்ஸ்கி என்ற ரஷ்ய அறிஞர் சிந்துச் சமவெளி நாகரிகக் காலத்தில் யோகாசனம் இருந்ததை உறுதிப்படுத்தினார். அந்த ஆசனத்துக்குப் பெயர் மூலபந்தாசனம்.

இந்த மாதிரி ஆசனத்தில் யாராவது இருக்கிறார்களா என்று ஆராய்ச்சியாளர் தேடியபோது, இந்தியாவில் ஸ்ரீ கிருஷ்ணமாச்சாரியார் செய்கிறார் என்று கேள்விப்பட்டு, அவர் வீடு தேடி வந்து பார்த்தார்கள். அது கச்சிதமாகப் பொருந்துகிறது என்று ஆச்சரியப்பட்டார்கள்.

யோகா ஏதோ ஹிந்து சமாசாரம், மோடி அரசின் அரசியல் நகர்வு என்று நினைக்காமல், யோகா பற்றி நம் இளைய சமுதாயத்துக்கு எடுத்துச் சொல்ல வேண்டியது ஒவ்வொரு பெற்றோர்களின் கடமை. ஸ்ரீ கிருஷ்ணமாச்சாரியார் பற்றி நாம் எந்த ஆவணப்படமும் எடுக்கவில்லை, வெளிநாட்டவர்கள்தான் எடுத்துள்ளார்கள் என்பது வருத்தமான விஷயம்.

உடம்பு ரஜோ குணத்தை படிப்படியாகக் குறைத்து, ‘லெத்தார்ஜி’யாக இருக்கிறது என்கிறோமே, அதை முற்றிலும் நீக்கி சுறுசுறுப்பு தருகிறது யோகா. குழந்தைகளை லட்சக்கணக்கில் பணத்தைக் கொட்டி படிப்பைச் சொல்லித் தருவதைவிடவும் முக்கியமானது, அவர்கள் காலை நீட்டி மடக்கி யோகா செய்யச் சொல்லித் தருவது. இதனால் அவர்கள் எதிர்காலம் ஆரோக்கியமாக அமையும்.
 
ஸ்ரீகிருஷ்ணமாச்சாரியார் பற்றிய நூல்: ஒரு யோகியின் சரிதம் – யோகாச்சார்யா ஸ்ரீ கிருஷ்ணமாச்சார்யா. 





டெஸ்ட் டியூப்பில் இண்டர்நெட் – சுஜாதா தேசிகன்



 

நிக் கோல்ட்மேனுக்கு (கணிதவியலாளர் மற்றும் மரபணு விஞ்ஞானி) அமெரிக்காவிலிருந்து ‘ஃபெட் எக்ஸ்’ மூலம் கூரியர் ஒன்று வந்து சேருகிறது. சுண்டு விரல் அளவுக்கு ஒரு டெஸ்டியூப். ஆனால் காலியாக இருக்கிறது. ஏமாற்றத்துடன் தன் நண்பரிடம் சொல்ல, நண்பர் வெளிச்சத்தில் அதைப் பார்த்தார் கீழே துளி அளவு அழுக்கு மாதிரி ஒரு வஸ்துவைப் பார்த்து “சரியா பாருங்க கீழே ஒட்டிக்கொண்டு இருக்கு” என்றார்.

நிக் உடனே அந்தக் கடுகு சைஸ் அழுக்கைத் தண்ணீரில் கலந்து ஒரு இயந்திரத்துக்கு அனுப்பி அதில் என்ன இருக்கிறது என்று படிக்க ஆரம்பிக்கிறார். படித்து முடிக்க கொஞ்ச நேரம் ஆகும், அதுவரை சில விஷயங்களை உங்களுக்குச் சொல்கிறேன்.

உங்களிடம் முகம் பார்க்கும் கண்ணாடி இருக்கிறதா? அதில் உங்கள் முகத்தைப் பாருங்கள். சுமாராகத் தெரிந்தால் போதும், மேற்கொண்டு படிக்கலாம். என்ன தெரிகிறது? முகம், கண், மூக்கு, முடி… சரி இவை எல்லாம் உயிரணுக்கள் (cells)! நம் உடலில் கிட்டதட்ட பத்து டிரில்லியன் (1000000000000) உயிரணுக்கள் (cells) உள்ளன. தசைகள், குடல், முடி என்று கிட்டதட்ட 200 வகை உயிரணுக்கள் நம் உடலில் இருக்கின்றன. ஒவ்வொன்றும் ஒரு வகை.
மீண்டும் உங்கள் முகத்தைப் பாருங்கள். நீங்கள் பார்க்கும் கண் லென்ஸ் கூட ஒரு வகை உயிரணுதான்! உங்கள் விரல் நுனியில் 2-3 பில்லியன் செல்கள் இருக்கின்றன. செல்லின் அளவு, ஒற்றைத் தலைமயிரின் விட்டத்தில் (diameter) பத்தில் ஒரு பாகம் மட்டுமே.
எலும்பு உடைந்தால் மீண்டும் வளர்கிறது. பல் விழுந்தால் மீண்டும் முளைக்கிறது. ஆல மரத்தின் சின்ன விதையில் இலை, விழுது என எல்லாம் புரோகிராம் செய்யப்பட்டுள்ளன. எதில்? டி.என்.ஏ என்ற மரபணுவில்.

தனுஷின் உண்மையான பெற்றோர் யார்? தனுஷுக்கு டி.என்.ஏ பரிசோதனை!என்பது தினத்தந்தி செய்தியாகி, டி.என்.ஏ பழக்கபட்ட வார்த்தையாகிப் பல நாள் ஆகிவிட்டது. டி.என்.ஏ என்றால். சர்க்கஸில் நாம் பார்க்கும் முறுக்கிவிட்ட நூலேணி மாதிரி ஒரு பிம்பம் என்று இந்நேரம் உங்களுக்குத் தெரிந்திருக்கும். அந்த நூலேணி சமாசாரம்தான் உங்கள் உயிரணுவில் இருக்கிறது.
கொஞ்சம் டெக்கினிக்கலாகப் பார்த்தால் டி.என்.ஏ என்பது ‘டிஆக்சிரிபோநியூக்ளியிக் அமிலம்’ (deoxyribonucleic acid). பல வகை செல்கள் இருக்கின்றன என்று பார்த்தோம். நம் உடலின் அங்கங்கள் எப்படி உருவாக வேண்டும் என்ற தகவல்கள் எல்லாம் இந்த டி.என்.ஏவில்தான் பொதிந்திருக்கின்றன.

இந்த நூலேணிப் படிகளில் விதவிதமான புரோட்டீன்களை எப்படி உற்பத்தி செய்யவேண்டும் என்ற குறிப்பு இருக்கிறது. இந்த ரகசியத்தைத்தான் ஜீன் (Gene) என்கிறார்கள். முக அமைப்பு, நிறம் போன்ற தகவல்கள் எல்லாம் இந்த ஜீன்களில்தான் இருக்கின்றன. எல்லா மனிதர்களின் ஜீன்களும் 98-99% ஒரே மாதிரிதான் இருக்கும். மிச்சம் இருக்கும் 1-2%தான் என்னையும், இதைப் படிக்கும் உங்களையும் வேறுபடுத்துகிறது.
உங்கள் எச்சில், நகம், ரத்தம் என்று எல்லாவற்றிலும் டி.என்.ஏ இருக்கிறது. எல்லாம் உயிரணுதானே! கடித்துத் துப்பிய நகம் மீண்டும் வளர்வது, கொசு கடித்துச் சொறிந்த கீறல் ஆறுவது, அடுத்த வீட்டுப் புளிப்பு தோசை வாசனை, பாடல், நிறம் எல்லாம் இங்கேதான் பதிவு செய்யப்பட்டுள்ளன.

யார் இந்த ரகசியங்களை அதில் எழுதினார்கள்? கடவுள் என்று சொல்லலாம், தலை எழுத்து என்றும் சொல்லலாம்.

கடவுள்தான் டி.என்.ஏவில் ரகசியங்களை எழுத முடியுமா? பென் டிரைவில் எழுதிவைப்பது மாதிரி நாமும் அதில் எழுதிவைக்க முடியாதா? முடியும் என்கிறது விஞ்ஞானம்.
டி.என்.ஏவின் நூலேணியில் நாம் அடுத்த படிக்குச் செல்லாலாம். மரபணுவில் தகவல் பொதிந்திருக்கிறது என்று 1928ல் வழக்கம்போல எலியை வைத்துக் கண்டுபிடித்தார்கள். ஆனால் அப்போது டி.என்.ஏவின் கூட்டமைப்புப் பற்றிக் கண்டுபிடிக்கப்படவில்லை.
எலியை வைத்துச் சோதனை செய்யுமுன் இரண்டு விதமான பாக்டீரியாவை (நுண்ணுயிர்) உங்களுக்கு அறிமுகம் செய்கிறேன். ஒன்று S வகை, இன்னொன்று R வகை. S வகை ஸ்மூத்தாக இருக்கும், ஆனால் நிமோனியாவை ஏற்படுத்தும். R வகை கரடுமுரடாக இருக்கும். ஆனால் சாது என்று மட்டும் தெரிந்துகொள்ளுங்கள்.

எலிக்கு S வகையைச் செலுத்தினார்கள். நிமோனியா வந்து இறந்தது. எலிக்கு R வகையைச் செலுத்தினார்கள், ஒன்றும் ஆகவில்லை. S வகை நுண்ணுயிர்களை வெப்பமூட்டிக் கொன்றுவிட்டுப் பிறகு எலியில் செலுத்தினார்கள். எலிக்கு ஒன்றும் ஆகவில்லை. கடைசியாக R வகையைச் செலுத்தி, கூடவே வெப்பமூட்டிய S வகையையும் செலுத்தினார்கள். எலிகள் மீண்டும் மாண்டன.
வெப்பமூட்டி S வகை நுண்ணுயிர்கள் பொசுங்கினாலும் R வகையுடன் சேரும்போது மீண்டும் நிமோனியா நுண்ணுயிர்கள் உயிர்பெற்றன. அதாவது எங்கோ ஏதோ தகவல் ஒட்டியுள்ளது என்று கண்டுபிடித்தார்கள். 1940ல் அது டி.என்.ஏ என்று கண்டுபிடித்தார்கள்.


இந்தக் கட்டுரையை படிப்பது போல டி.என்.ஏவைப் படிப்பது சுலபம் இல்லை (பல நாள் ஆகும்; டி.என்.ஏ சரடைச் சேமிக்க நிறைய மெமரி வேறு வேண்டும்). உதாரணத்துக்கு டி.என்.ஏவைப் படித்தால் இப்படி இருக்கும் ATCATGCA… ஒவ்வொரு எழுத்தும் ஒரு கூட்டணுவைக் குறிக்கிறது – நியுக்ளியோ-டைடுகள் (nucleotides) அதாவது A-அடினைன், T-தயோமைன், C-சைடோசைன், G-குவானின் என்று பெயர்கள். இவை எல்லாம் புரதங்கள். ஜீன்கள் இவற்றை உண்டு பண்ணுகின்றன. இந்தப் புரதங்களின் வரிசைதான் நம் தலைவிதி. இதில்தான் தகவல் அடங்கியிருக்கிறது.

மனிதனாக இருந்தாலும், வெண்டைக்காயாக இருந்தாலும் டி.என்.ஏ ஒன்றுதான். டி.என்.ஏ தேவையான புரேட்டீன்களை உற்பத்தி செய்கிறது. என்ன விதமான புரோட்டீன் தேவை என்ற தகவல்கள் ஜீன்களில் இருக்கின்றன. அப்பா போன்ற கண்களும், அத்தை போன்ற குணங்களும் பரம்பரை பரம்பரையாக நம் மரபணுவில் ஹார்ட் டிஸ்க் போல் எங்கோ சேமித்து வைக்கப்பட்டுள்ள தகவல்களே!

நாம் சிடி, டிவிடி பென்டிரைவ், கையடக்க ஹார்டு டிஸ்க் போன்றவற்றில் சேமித்து வைத்துள்ள படம், பாடல்கள், வீடியோ, ஓசியில் கிடைத்த பிடிஎஃப் எல்லாம் நம் மரபணுவில் சேமிக்க முடிந்தால்? நகைச்சுவையாகப் பேச ஆரம்பித்து, சேமிக்க முடியும் என்று நம்பமுடியாத சாதனையைச் சாதித்துள்ளனர்.
நாம் தினசரி சாதாரணமாக உபயோகிக்கும் பென் டிரைவில் எப்படித் தகவல்கள் சேமிக்கப்படுகின்றன என்று சரியாக ஐந்து வரிகளில் சொல்கிறேன்.

பென் டிரைவ்களில் ஒரு சிறிய அச்சிடப்பட்ட சர்க்யூட் போர்டு இருக்கிறது. அதில் சிறிய ‘மைக்ரோசிப்’, தகவல்களைப் படிக்க, சேமிக்க உதவுகிறது. குறைந்த மின்சார சக்தி கொண்ட தகவல் சேமிப்பு EEPROM அடிப்படையிலானது. அதில் தகவல் எழுதவோ அழிக்கவோ முடியும். தகவல்கள் எல்லாம் ‘0’ அல்லது ‘1’ ஆகவோ சேமிக்கப்படுகின்றன. படமோ, பாடல்களோ உள்ளே எல்லாம் 0 அல்லது 1. இதை ‘பிட்’, ‘பைட்’ என்று நான்காம் வகுப்புக் குழந்தைகூடச் சொல்லிவிடும்.

நமது தகவல்களின் ‘பிட்’டை மரபணுவின் A, C, T, G பாஷையில் மாற்றி, தகவல்களைப் பிரதிபலிக்கும் மூலக்கூறை அமைக்க முடிந்தால்? கட்டுரை ஆரம்பத்தில் நிக் கோல்ட்மேன் நினைவிருக்கிறதா?

2011 பிப்ரவரி 16 அன்று ஜெர்மனியில் ஒரு ஹோட்டலில் நிக் கோல்ட்மேன் சக மரபணு ஆராய்ச்சியாளர்களுடன் பேசிக்கொண்டிருந்தார். “மரபணு சேமிக்க நிறைய மெமெரி தேவைப்படுகிறது, செலவும் அதிகமாகிறது” என்றார். அப்போது ஒருவர் “பேசாம மரபணு தகவல்களைச் சேமிக்க மரபணுவையே உபயோகிக்க வேண்டியதுதான்” என்று ஜோக்காக கமெண்ட் அடிக்க, ‘சபாஷ் நாயுடு’ போஸ்டரில் பல்ப் எரிவது போல ஐடியா உதயமாகி “ஏன் அப்படிச் செய்ய கூடாது” என்று டேபிளில் இருந்த ‘டிஷ்யூ’ பேப்பரில் அவர்கள் ஐடியாக்களை எழுத ஆரம்பித்தார்கள்.

இரண்டு வருடம் கழித்து தாங்கள் செய்த சோதனை வெற்றி என்றார்கள்!

என்ன செய்தார்கள்? சொல்கிறேன். ஷேக்‌ஸ்பியர் நாடகத்தின் ஒரு பகுதி, புகழ்பெற்ற மார்ட்டின் லூதர் கிங்கின் சில நிமிடப் பேச்சின் MP3 வடிவம், முதல் டின்.என்.ஏ பற்றிய ஆராய்ச்சிக் கட்டுரை, அவர்களது ஆராய்ச்சிக் கூடத்தின் படம், இவர்கள் செய்யும் ஆராய்ச்சி பற்றிய கட்டுரை என்ற ஐந்தையும் டி.என்.ஏ குறியீடாக மாற்றினார்கள். “Thou art more lovely and more temperate” என்ற சேக்‌ஷ்பியர் வரியை டி.என்.ஏ குறியீடாக “TAGATGTGTACAGACTACGC” மாற்றி இதை இணையம் வழியாக அமெரிக்காவிற்கு அனுப்பினார்கள். அவர்கள் அதைச் செயற்கை முறையில் தயாரிக்கப்பட்ட (Synthetic DNA) மரபணுவில் குறியீடாகச் செலுத்தி (கலர் பிரிண்டர் மாதிரி இந்த டி.என்.ஏவை அச்சடிப்பார்கள் என்று வைத்துக்கொள்ளுங்கள்) டெஸ்டியூபில் பேக் செய்து அனுப்பினார்கள். கட்டுரையின் ஆரம்பத்தை மீண்டும் ஒருமுறை படியுங்கள். டெஸ்டியூபின் கீழே ஒட்டிக்கொண்டு இருந்த அந்தத் துளியூண்டைத் தண்ணீரில் கலந்து அதைப் படித்தபோது அவர்கள் அனுப்பிய ஷேக்‌ஸ்பியர் வரிகள், எம்.பி3 பேச்சு, கட்டுரை, படம் எல்லாம் அச்சு அசலாக அப்படியே ‘மீண்டும்’ கிடைத்தது டி.என்.ஏ வழியாக!

டெஸ்டியூப் உள்ளே ஒட்டிக்கொணடிருந்தது கடுகு சைஸில் இவ்வளவு. இதையே டெஸ்ட்யூப் முழுக்க இருந்தால் அதில் பொதிந்துள்ள விஷயம் கிட்டத்தட்ட பத்து லட்சம் சி.டிக்களில் அடங்கும் தகவல்களாக இருக்கும்.

உலகத்தில் உள்ள தகவல்களை எல்லாம் ஒரு கார் டிக்கியில் அடக்கிவிடலாம்! டி.என்.ஏ படிக்க முன்பு பெரிய இயந்திரங்கள் தேவைப்பட்டன. ஆனால் இன்று வீட்டில் ரத்தத்தில் சக்கரை பரிசோதிக்கும் மீட்டர் போல ஒன்றை வைத்து சில மணி நேரத்தில் படித்துவிடலாம். மரபணுவை அச்சடிப்பதற்கு மட்டும் நிறைய செலவு ஆகிறது, இன்னும் கொஞ்ச நாளில் அதையும் குறைத்துவிடுவார்கள்.

பென் டிரவ் போய் தம்ப் (Thumb) டிரைவ் உங்கள் பேரன் காலத்தில் வந்துவிடும். கட்டை விரலை கம்யூட்டர் யூ.எஸ்.பி ஓட்டையில் நுழைத்தால் பாகுபலி படம் பார்க்கலாம்.

சிடி, பென் டிரைவில் தகவல் சில வருடங்களே இருக்கும். ஆனால் டி.என்.ஏ பல ஆயிரம் வருடங்கள் இருக்கும். குளிர் பிரதேசம், வெளிச்சம் இல்லை என்றால் பல லட்சம் வருடங்கள் கூட இருக்கும். இன்றும் மம்மிகள் கண்டுபிடித்து எடுக்கும்போது அதில் டி.என்.ஏ அழியாமல் இருக்கிறது. அண்டார்ட்டிகாவில் பனியில் உறைந்த பல விங்குகளில் பொதிந்துள்ள டி.என்.ஏவை விஞ்ஞானிகளால் படிக்க முடிகிறது. ‘டி.என்.ஏ’ பென் டிரைவ் வந்துவிட்டால் வழக்கம்போல் தகவல் சேமித்து அதை ஃபிரிட்ஜில் வைத்தால் போதும், ஜன்மத்துக்கும் அழியாது.
செயற்கை மரபணுவில் சேமிக்கலாம், உயிருள்ள டி.என்.ஏவில் சேமிக்க முடியுமா? டி.என்.ஏவை உயிருள்ள அணுக்களில் செலுத்தி அதிலும் வெற்றி கண்டுள்ளார்கள். ஏன் டி.ன்.எவை வைத்து ஆபரேட்டிங் சிஸ்டம், கிளவுட் கம்ப்யூட்டிங், வைரஸ் கூடத் தயாரித்துவிட்டார்கள் என்பதையெல்லாம் இன்னொரு தனி கட்டுரையாக எழுதலாம்.

நிக் கோல்ட்மேன் டிவிட்டரில் இருக்கிறார். இந்தக் கட்டுரையை எழுதும்போது அவரை வெறும் 1,114 பேர் பின்தொடர்கிறார்கள். உலக நாயகன் கமலை 1.77 மில்லியன் பேர் பின்தொடர்கிறார்கள்.

கோமாளிகளின் டி.என்.ஏ!

******* 

மலச்சிக்கல் – சுஜாதா தேசிகன்

எழுபது வயதில் காலை எழுந்தவுடன் சுகமாக பாத்ரூம் போனாலே சந்தோஷப்படுகிறேன்” – சுஜாதா, தனது எழுபது வயது கட்டுரையில்.

மலமோ, மாநிலமோ எது பந்த் செய்தாலும் கஷ்டம்தான். சாப்பிட்டபின் என்ன ஆகிறது என்று அறிந்துகொண்டாலே மலச்சிக்கலைப் புரிந்துகொள்ள முடியும் என்பது என் Gut Feeling!

ஹைவேயில் 130கிமீ வேகத்தில் கார் ஓட்டிக்கொண்டு போகும்போது நடுவில் சுங்கச்சாவடி வரிசை. பிரேக் போட்டு நின்றுவிடுகிறீர்கள். முன்பு இருக்கும் வண்டிக்கு ஏதோ பிரச்சினை. ஸ்டார்ட் ஆகாமல் நிற்க, பின்னாலே பெரிய வரிசை. முன் பின் நகர முடியாமல் இருக்கும் கார் போல சிக்கலில் மலம் மாட்டிக்கொண்டால்? மலச்சிக்கல்!

வாய் முதல் ஆசனவாய் சுமார் இருபத்தெட்டு அடி நீளமுள்ள ஒரு வழிப் பாதை (குழாய்). இந்த ஹைவேயில் சாப்பாட்டுடன் பயணம் மேற்கொள்ள வாசகர்களை அன்புடன் அழைக்கிறேன். பயண நேரம் பதினெட்டு முதல் இருபத்தி நான்கு மணி நேரம். பயணத்தின்போது ஏதாவது (மல)சிக்கல் ஏற்படாமல் இருக்க இயற்கைக் கடவுளை வேண்டிக்கொண்டு பிடித்த உணவை வாயில் போட்டுக்கொண்டு புறப்படுங்கள்.

முதலில் கண். கண்ணுக்கும் சாப்பாட்டுக்கும் என்ன சம்பந்தம் என்று யோசிக்கலாம். இருக்கிறது. ஜிலேபியோ, இட்லியோ, சாப்பாட்டு ஐட்டங்களைப் பார்த்தவுடன் கண் நரம்புகளின் வழியாகப் படம் பிடித்து, இனிப்பு/காரச் செய்தியாக மூளைக்கு அனுப்புகிறது. உணவு கிடைக்கும் என்ற நம்பிக்கையில் நாக்கில் எச்சிலும், வயிற்றில் செரிமானத்துக்குத் தேவையான திரவங்களும் சுரக்கின்றன.

அடுத்து மூக்கு. மூக்குத்திக்கு மட்டும் இல்லை வாசனைக்கும் மூக்கு மிக அவசியம். சூடாக இருந்தாலும், வாசனை இல்லாத காபி வெந்நீர்தானே?

அடுத்து வாய். தாடை, பற்கள், நாக்கு என்று வலுவான தசைகள் ஒன்றாக வேலை செய்யும் இடம். கன்னங்கள், நாக்கு அடியில் புடைத்திருக்கும் இடங்களில் உமிழ்நீர் சுரக்கும். உமிழ்நீரில் உள்ள என்சைம்கள் செரிமானத்துக்கான முதல் வேலையை ஆரம்பிக்கிறது.

வாய் ஒரு துவாரம், ஆசனவாய் ஒரு துவாரம். இதற்கு நடுவில் மூன்று துவாரங்கள் இருக்கின்றன. இவை இல்லாவிட்டால் சாப்பிட்டவுடன் குமட்டலாக வாந்தி எடுத்துவிடுவோம்.

உணவு தொண்டைக்குச் செல்கிறது. உணவுக் குழாயையும் வாயையும் இணைக்கும் பகுதி தொண்டை. முழுங்கும்போது மூக்கையும், குரல்வளையையும் (vocal chord) அடைத்து, சாப்பாட்டை உள்ளே அனுப்புகிறது. இப்பவே கொஞ்சம் எச்சிலை முழுங்கிப் பாருங்கள். காதில்கிளிக்என்று சத்தம் கேட்கிறதா? தொண்டைப் பகுதி மேலே செல்கிறதா? ஆம் என்றால், உங்களுக்கு இவை எல்லாம் சரியாக வேலை செய்கிறது. மேலே பயணிக்கலாம்.
அடுத்து உணவுக்குழாயை அடைகிறது. ஐந்து முதல் பத்து நொடியில் சாப்பிட்ட உணவு இதில் பயணிக்கிறது. விரிந்துகொடுத்து உணவை உள்ளே அனுப்புகிறது. திரும்ப வாய்ப் பக்கம் ரிவர்ஸ் கியரில் வராமல் இருக்க மூடிக்கொள்கிறது. சிரஸாசனம் செய்யும்போது சாப்பிட்டாலும் வெளியே வராமல் இருப்பதற்கு இதுதான் காரணம். ஒரு நாளைக்கு 600 முதல் 2000 முறை முழுங்குகிறோம். முழுங்கியது எல்லாம் வயிற்றுக்குச் செல்கிறது.

வயிற்றுக்கு வந்துவிட்டது உணவு. ‘எதையும் தாங்கும்இதயம் என்று சொல்லிவிட்டுப் போய்விட்டார்கள். உண்மையில் எதையும் தாங்குவது நம் வயிறுதான். கொதிக்கும் காபி முதல் கரகர பக்கோடா வரை, மேல் நாக்கைப் பொரித்துவிட்டு, தொண்டையைக் கடந்த பிறகு சூடு தெரிவதில்லை. அதுமட்டும் இல்லை, நம் இரைப்பையில்ஹைட்ரோ குளோரிக் அமிலம்இருக்கிறது என்றால் நம்புவீர்களா? அதை ஒரு பாட்டிலில் பிடித்து அடித்தால் ரவுடிகள் வீசும் ஆசிட் தோற்றுவிடும்.

ஹைட்ரோ குளோரிக் அமிலமா என்று கேட்பவர்கள் பின்வரும் பகுதியைப் படிக்க சிபாரிசு செய்கிறேன்.

1822, ஜூன் 6 அலெக்ஸ் மார்டினை ஒரு துப்பாக்கி குண்டு துளைத்தது. யாரும் சுடவில்லை. விபத்து. சுடப்பட்ட இடம் வயிறு. டாக்டர் பியூமாண்ட் அவருக்குச் சிகிச்சை அளித்தார். ‘இன்னும் கொஞ்ச நாள்தான்என்று நினைத்தார். ஆனால் மார்டின் பிழைத்துக்கொண்டார். வயிற்றில் குண்டு அடிபட்ட ஓட்டை மட்டும் ஆறவே இல்லை. ஓட்டையாகவே இருந்தது!

மார்டின் வேலை செய்த கம்பெனி அவரை ஓட்டையுடன் வேலை செய்ய முடியாது என்று வீட்டுக்கு அனுப்பியது. டாக்டரிடமே எடுபிடியாக வேலைக்குச் சேர்ந்தார்.

அடுத்தவன் வீட்டில் இருந்தால் என்ன, வயிற்றில் இருந்தால் என்ன, ஓட்டை இருந்தாலே எட்டிப்பார்ப்பது மனித இயல்புதானே. மார்ட்டின் வயிற்றின் ஓட்டையில் என்ன நடக்கிறது என்று பார்க்க ஆரம்பித்தார் டாக்டர். தூண்டிலில் சின்ன புழுவைக் கட்டி மீன் பிடிப்பது மாதிரி சின்ன பீஸ் உணவை நூலில் கட்டி அவர் வயிற்று ஒட்டையில் விட்டு ஒரு மணிக்கு ஒருமுறை அதை எடுத்து பார்த்துப் பரிசோதனையை ஆரம்பித்தார். கூடவே அதனுடன் வந்த இரைப்பை அமிலத்தையும் எடுத்துப் பரிசோதித்தார்.

சில மாதங்களில் மார்ட்டின் டாக்டரிடமிருந்து தப்பித்து ஓடினார். ஆனால் டாக்டர் விடவில்லை. அவரைத் தேடிக் கண்டுபிடித்து மீண்டும் பரிசோதனையைத் தொடர்ந்தார்.

ஓட்டையிலிருந்து எடுத்த அமிலத்தை உணவின் மீது செலுத்தி அது என்ன ஆகிறது என்று பார்த்தார். முக்கியமான கண்டுபிடிப்பு நிகழ்ந்தது.

வயிற்றில் உணவை ஜீரணிக்க மாவு மிஷின் மாதிரி எல்லாம் எதுவும் இல்லை. எல்லாம் வேதியியல் முறையில் செயல்படுகிறது என்று கண்டுபிடிக்கப்பட்டது. அந்த அமிலம் கையில் பட்டால் நம் கை ஓட்டையாகும்! ஹார்பிக் என்ற நம் கழிப்பறையைச் சுத்தம் செய்யும் வஸ்துவில் 10% இந்த அமிலம்தான் இருக்கிறது. நம் வயிறு, ஆசிட் வைத்திருக்கும் ரவுடி!

சாப்பிட்ட உணவு பட்டாணியோ, பன்னீர் பட்டர் மசாலோவோ, எல்லாம் இரைப்பையை வந்து சேருகிறது. வாஷிங் மிஷினில் சோப்பு போட்டவுடன் அது தண்ணீருடன் கலந்து அழுக்கை எடுப்பது போல, இந்தக் கரைசல் நம் வயிற்றுச் சாப்பாட்டை ஜீரணம் செய்கிறது. வாஷிங் மிஷின் உள்ளே டிரம் இப்படியும் அப்படியும் அசைவது மாதிரி, இரைப்பையின் தசைகள் பாபா ராம் தேவ் செய்வது மாதிரி சுருங்கி விரிந்து அரைக்கிறது.

இங்கிருந்து சின்ன துவாரம் வழியாகச் சிறுகுடலுக்கு அனுப்புகிறது. அங்கேதான் ஹைட்ரோ குளோரிக் அமிலம் செயல்பட ஆரம்பிக்கிறது. அமிலத்துடன் கல்லீரல் கணையத்திலிருந்து ஜீரண நீர் கலந்து உணவில் இருக்கும் புரதச்சத்துஅமினோ அமிலமாகவும்; மாவு சத்துசர்க்கரையாகவும்; கொழுப்புகொழுப்பு அமிலமாகவும் பிரிக்கும் வேலைகள் நடக்கின்றன. மீதம் இருக்கும் கழிவுகளைப் பெருங்குடலுக்கு அனுப்புகிறது. வண்டி ஸ்மூத்தாக ஓட ஆயில் தேவைப்படுவது போல, பெருங்குடலில் கோழை மாதிரி ஒரு லூப்ரிகண்ட் உற்பத்தி ஆகி, மலத்தை இளகவைத்து அடுத்த நாள்மகிழ்ச்சிஎன்று சொல்ல வைக்கிறது..

எப்படி வாஷிங் மிஷின் துணியைப் பிழிந்து அழுக்குத் தண்ணீரை வெளியே தள்ளுகிறதோ, அதே மாதிரி சிறுகுடல் உணவில் உள்ள சத்துக்களை எடுத்துக்கொண்டு தேவை இல்லாதவற்றைப் பெருங்குடலுக்கு அனுப்புகிறது. பெருங்குடலுக்கு வந்து சேருபவை எலும்புத் துண்டு, பழக் கொட்டை (மாங்கொட்டை இதில் சேராது), நார்ச்சத்து போன்றவை.

ஒரு நாளைக்கு இரண்டு அல்லது மூன்று முறைதான் பெருங்குடல் சிணுங்கும். அப்படிச் சிணுங்கும்போது மலம் வர தயாராகும். கண்டதைச் சாப்பிட்டு அதிகமாகச் சிணுங்க வைத்தால் டாய்லெட்டுக்கு விசிட்டிங் ப்ரொஃபசராக இருந்த நீங்கள், நிரந்திர ப்ரொஃபசராக அங்கேயே இருப்பீர்கள்.

காலை சூடாக காபி சாப்பிட்டால்தான் சிலருக்குஅது வரும்.’ (அதனுடன் சிலருக்குச் சிகரெட்டும் பிடிக்க வேண்டும்.) சூடான காபி இரைப்பையின் நரம்புகளைத் தூண்டி, அது பெருங்குடலை சிணுங்க வைத்துஅதுதான் விஷயம்! இப்போது கடைசிப் பகுதிக்கு வந்துவிட்டோம். மூச்சைப் பிடித்துக்கொள்ளுங்கள்.

ஆசனவாயை ‘Anal Sphincter’ என்பார்கள். பாட்டியின் சுருக்குப்பை மாதிரி இருக்கும் இதற்கும் நம் மூளைக்கும் சம்பந்தம் இருக்கிறது என்றால் நம்புவீர்களா? ஆசவனாய்க்கு சில சென்டிமீட்டர் முன் இன்னொரு சுருக்குப்பை இருப்பது பலருக்குத் தெரிவதில்லை.

வெளியே இருக்கும் சுருக்குப்பைதான் நம் மூளையின் கட்டுப்பாட்டில் இருக்கிறது. மீட்டிங்கின்போதுஅவசரம்என்றாலும் நம்மால் அடக்கிக்கொள்ள முடிகிறது. ஆனால் உள்ளே இருக்கும் விஷயம் அப்படி இல்லை. தன்னுணர்வற்ற (unconsciousness) முறையில் செயல்படுகிறது. உள்ளே எல்லாம் சரியாக இருக்கிறதா (பிரஷர் ஒகேவா?) என்று பார்த்துக்கொள்ள வேண்டியது இதனுடைய பொறுப்பு.

இது இரண்டும் எப்படி வேலை வேலை செய்கின்றன? டிவியில் டாக் ஷோவில் அதை நடத்துபவர் மைக் மூலம் சொல்லுவது மாதிரி உள்ளிருக்கும் சுருக்குப்பைஇந்தாப்பா கொஞ்சம் சாம்பிள்என்றுஅதைடெஸ்டுக்கு அனுப்பும். வெளியே இருக்கும் சுருக்குப்பை மதகுகளைத் திறப்பதற்கு முன் பல சென்சார் செல்களால் அதை ஆராய்ந்துஇன்னிக்கு ரொம்ப கெட்டி போலஅல்லதுஐயோ இவ்வளவு தண்ணியாவா…? நேற்று என்ன சாப்பிட்டேன்என்று யோசிக்கத் தொடங்கும். அல்லதுவிடுங்கவெறும் காற்றுதான்என்று விட்டுவிடும். அல்லதுமாஸ்டர் இன்னொரு சூடான டீஎன்று ஆர்டர் செய்யும்.

சுற்றுப்புறச் சூழலைக் கவனித்து, டாய்லெட் போக வேண்டுமா வேண்டாமா என்பதை மூளை முடிவு செய்யும். அதனால்தான் வீட்டில் கிடைக்கும் நிம்மதி, வெளியே போகும்போது கிடைப்பதில்லை. டாய்லெட் போகும்போது யாராவது நம்மைக் கூப்பிட்டால் சுருக்குப்பை உடனே மூடிக்கொள்ளும். இது எல்லாம் சென்சார் செல்களின் வேலையே.

இன்று பத்தில் மூன்று பேருக்குசரியாபோகலை பிரச்சினை இருக்கவே செய்கிறது. மலம் பெருங்குடலில் மாட்டிக்கொண்டு வெளியே வர வேலைநிறுத்தம் செய்கிறது. பச்சை சிக்னல் வந்த பிறகும் நமக்கு முன்னே இருக்கும் வண்டி போகாமல் இருப்பது மாதிரி. நரம்புகளும், வயிற்றுத் தசைகளும் ஒன்றாகச் சேர்ந்து இயங்காததால் வரும் பிரச்சினை.

அதுக்குஅடிக்கடிப் போக வேண்டும் என்பது பலருக்குப் பிரச்சினையாக இருப்பதில்லை ஆனால் ஸ்மூத்தாக போக முடிகிறதா என்பதுதான் பிரச்சினையே.

ஸ்கூட்டியில் போகும் பெண் போலவோ அல்லது தீவிரவாதிகள் போல முகத்தை மூடிக்கொண்டோ கீழே உள்ளதைப் படிக்கவும்.
.
மலத்தின் அளவு:

நாம் சாப்பிடும் சாப்பாடு மட்டுமே மலமாக வெளியே வருகிறது என்று நினைத்துக்கொண்டு இருக்கிறோம். நம் உடல் நாம் சாப்பிடும் உணவில் தேவையானவற்றை உறிஞ்சி உபயோகத்துக்கு எடுத்துக்கொள்கிறது. இதை தவிர பல நுண்ணங்களும், குடலிலிருந்து சேரும் பலவகைக் கழிவுகளும் சேர்ந்து மலமாக வெளிவருகிறது. அரைக்கிலோ உணவு உண்டுவிட்டு அரைக்கிலோ மலம் வரும் என்று எதிர்பார்க்கக் கூடாது!

மலத்தில், மூன்று பங்கு நீர்தான். மீதம் ஒரு பங்கில் ரிடையர் ஆன பாக்டீரியாக்கள், பழம், காய்கறிகளின் நார்ச்சத்து, தேவை இல்லை என்று உடல் ஒதுக்கிய மருந்து மாத்திரைகள், உணவுகளில் இருக்கும் வண்ணம், கொலஸ்டாரால் போன்றவை.

மலத்தின் துர்நாற்றம்:

பெரிய குடலில் மலம் தங்கிச் செல்லும் காலத்தில் இண்டால், ஸ்கேட்டால் என்ற வேதி வஸ்துக்களால் துர்நாற்றம் ஏற்படுகிறது. மாமிச உணவு, குடலில் நோய், குறைவான பித்தம் போன்றவை அதிக துர்நாற்றம் ஏற்படுத்தும்.

மலத்தின் நிறம், தன்மை:

மலம் பொதுவாகப் பழுப்பு நிறமாக இருக்கும். ஆனால் சில சமயம் நீலம், மஞ்சள், பச்சை, சிகப்பு என்று காட்சி தரும். மலத்தின் நிறம் ஏன் பழுப்பாக (அல்லது மஞ்சளாக) இருக்கிறது?

தினமும் நம் உடல் உற்பத்தி செய்யும் முக்கியமான வஸ்துதான் காரணம்ரத்தம்! நம் உடல் ஒரு நாளைக்கு 24 லட்சம் ரத்த அணுக்களை உற்பத்தி செய்கிறது. அதே சமயம் அதே அளவுக்குப் பழசை வெளியேற்றவும் செய்கிறது. அப்படி உடைத்து வெளியேற்றம் செய்யும்போது சிகப்பு பச்சையாக, பிறகு மஞ்சளாக மாறுகிறது. இது எல்லாம் கல்லீரல் மற்றும் வயிற்றுக்குச் செல்லும்போது, அங்கே இருக்கும் பாக்டீரியா அதன் நிறத்தைப் பழுப்பு (brown) நிறமாக மாற்றுகிறது. மலத்தை ஆராய்ந்தால் நம் உடலில் என்ன நடக்கிறது என்று பெரும்பாலும் கண்டுபிடித்துவிடலாம்.

இளம் பழுப்புமஞ்சள் நிறத்தில் இருந்தால்ரத்தத்தைப் பிரிக்கும் என்சைம் 30% தான் வேலை செய்கிறது என்று அர்த்தம். (இதற்கு Gilbert’s syndrome என்று பெயர்). பயப்பட வேண்டாம். சிலருக்கு வயிற்றில் பாக்டீரியா இன்பெக்ஷன் இருக்க வாய்ப்பு இருக்கும். ஆன்டிபயாட்டிக் எடுத்துக்கொண்டாலும் மலம் மஞ்சளாக இருக்க வாய்ப்பு உண்டு.

இளம் பழுப்புசாம்பல் நிறம்: கல்லீரல், வயிறு இணைப்பில் எங்கோ அடைப்பு. தினமும் சாம்பல் நிறம் அதிகம் பார்த்தால் நீங்களே டாக்டரை அணுகலாம்.

கருப்புசிகப்பு: உறைந்த ரத்தம் கருப்பாக இருக்கும்; புதிய ரத்தம் சிகப்பாக இருக்கும். எப்போதாவது கொஞ்சம் சிகப்பு ரத்தம் வெளியே வந்தால் பிரச்சினை இல்லை. (ஆவக்கா சாப்பிட்டிருக்கலாம்.) அடிக்கடி கருப்பாக இருந்தால் உறைந்த ரத்தமாக இருக்கலாம்.

மலம் என்ன பதத்தில் இருக்க வேண்டும் என்று 1997 வருடம்பிரிஸ்டல் ஸ்டூல்விளக்கப்படம் வெளியிடப்பட்டது. அதில் மலத்தை ஏழு விதமாக வகைப்படுத்தியிருக்கிறார்கள். நீங்களே பார்த்து ஒப்பிட்டுக்கொள்வது நலம்.


முதல் வகை: ஆட்டுப் புழுக்கை மாதிரி கெட்டியாக இருந்தால் நீங்கள் சாப்பிட்ட உணவு ஜீரணம் ஆகி வெளியே வர கிட்டதட்ட நூறு மணி நேரம் ஆகிறது என்று அறிந்துகொள்ளலாம். இது மலச்சிக்கல்.

ஏழாம் வகையில் பத்து மணிநேரத்தில் வெளியே வருகிறது. இது பேதி அல்லது வயிற்றுப்போக்கு.

நான்காம் வகை தான்மகிழ்ச்சிஎன்று சொல்லலாம்.

மூன்றாம் வகை, விரிசல் இருக்கும். பரவாயில்லை, நாட் பேட்.

நீங்கள் மூன்று, நான்கு குரூப்பை சேர்ந்தவர்களா? இதோ இன்னொரு டெஸ்ட் உங்களுக்குடாய்லட் போகும்போது மலம் தண்ணீரில் எவ்வளவு சீக்கிரம் கீழே போகிறது என்று பாருங்கள். முழுவதும் தண்ணீரில் முழுகிவிட்டால், மலத்தில் ஊட்டச்சத்துக்கள் இன்னும் இருக்கிறது என்று அறிந்துகொள்ளலாம். மெதுவாக ஸ்லோ மோஷனில் நடிகை நீச்சல் குளத்தில் இறங்குவது போல இறங்கினால் அதில் வாய்வுக் குமிழ்கள் இருக்கிறது என்று அர்த்தம். பயப்படத் தேவையில்லை.

இரண்டாம் வகை: கட்டியாக, அதே சமயம் குவியலாக இருக்கும். இதுவும் மலச்சிக்கல்தான். ஒன்றாம் வகை மாதிரி அவ்வளவு மோசம் இல்லை.

ஐந்தாம் வகைஉங்கள் உணவில் நார்ச்சத்து கம்மியாக இருக்கிறது.

ஆறாம் வகைகூழாகப் பஞ்சு போல இருக்கும். உங்கள் வயிற்றில் எங்கோ வீக்கம், அல்லது கட்டியாகக் கூட இருக்கலாம். குடலில் தடை ஏற்பட்டால் கழியும் மலம் பட்டையாக இருக்கும். மலம் பிளந்து காணப்பட்டால் (அடிக்கடி) பெருங்குடலின் கடைசிப் பகுதியில் கட்டி இருக்கலாம்.

மலச்சிக்கல்அடிக்கடி கேட்கப்படாத கேள்விகள்

1. முக்கிய காரணங்கள்?
பயணம், உணவு பழக்கம், உடல்நலக்குறைவு, மன அழுத்தம்.
2. மன அழுத்தமா?
ஆமாம். டாய்லெட் ரிலாக்ஸ் செய்யும் இடம் அங்கே இலக்கியம் படிக்காதீர்கள். மனத்துடன் மற்றவையும் இறுகிவிடும்.
3. இறுகிவிட்டால் என்ன செய்யலாம்?
வில்வப் பழம், பேரிச்சம் பழம் மலத்தை இளகச்செய்யும்.
4. பயணத்தின்போது ஏன் பிரச்சினை வருகிறது?
நம் வயிறு தினமும் என்ன சாப்பிடுகிறோம், எவ்வளவு தண்ணீர் குடிக்கிறோம், இரவா பகலா, எந்த நேரத்துக்கு எவ்வளவு முறை போகிறோம் என்று குறித்து வைத்துக்கொள்கிறது. பயணத்தின்போது இது எல்லாம் மாறுகிறது. கூடவே ஜெட்லாக் சமாசாரம் எல்லாம் சேர்ந்துகொண்டால் நம் வயிற்றின் நரம்பு மண்டலம் குழம்பிபோய் பிரேக் போட்டு நின்று விடுகிறது. பயணத்தின்போது நம் வயிறும் பயணிக்கிறது என்று நினைவில் வைத்துக்கொள்ளுங்கள்.
5.. என்ன செய்ய வேண்டும்?
நிறைய நார்ச்சத்து உள்ள உணவை அதிகமாக எடுத்துக்கொள்ளலாம். (பழம் காய்கறிகள்.) பயணத்தின் முதல்நாள் நார்ச்சத்து உணவை எடுத்துக்கொள்வது நல்லது. அதை சிறுகுடல் அப்படியே பெருங்குடலுக்கு அனுப்பிவிடும். நார்ச்சத்து கதவைத் தட்டினால் நாம் திறக்காமல் இருக்கமுடியாது.
6. தண்ணீர்?
நிச்சயம் நிறைய அருந்த வேண்டும். மூக்கு உலர்ந்து போன மாதிரி இருந்தால் உங்கள் உடலில் இருக்கும் நீரச்சத்து குறைந்துள்ளது என்று அர்த்தம்.
7. எங்க வீட்டு டாய்லெடில்தான் எனக்கு…?
நம்ம டாய்லெட் மாதிரி இல்லையேஎன மனக்கலக்கமே மலசிக்கலுக்கு முக்கியக் காரணமாக இருக்கலாம். அதனால்தான் பப்ளிக் டாய்லெட்ரொம்ப அர்ஜெண்ட்என்றால் மட்டுமே விசிட் செய்கிறோம். புது இடமாக இருந்தாலும்எல்லாம் நார்மல்என்று நினைத்துக்கொண்டு உட்காருங்கள்.
8. தினமும் எவ்வளவு தடவை?
ஒரு தடவை அல்லது இடண்டு தடவை எதேஷ்டம். தினமும் குறிப்பிட்ட நேரத்துக்குச் செல்வது அதைவிட முக்கியம்.
9. குறிப்பிட்ட நேரமா?
ஆமாம். தினமும் காலை ஏழு மணிக்கு டாய்லெட் என்று வைத்துக்கொள்வது நல்ல பழக்கம்தான். இரண்டு நிமிஷம் லேட் என்று பதறினால் டாய்லெட் சரியாக வராது! காலைக்கடனைக் கடனே என்று போகாதீர்கள். சீரியல் பார்க்க வேண்டும் என்று அடக்கிக்கொள்ளக்கூடாது.
10. உடற்பயிற்சி?
உடற்பயிற்சி மலம் கழிக்க உதவுகிறது என்பது நிஜம். தினமும் நடைப்பயிற்சி செய்துவிட்டு நிறுத்தினால் சிலருக்கு மலச்சிக்கல் ஏற்படும்.
11. எப்படி உட்கார வேண்டும்?
மலம் கழிக்க உட்காரும்போது எந்த நிலை உங்களுக்குச் சரியாக இருக்கிறது என்று பாருங்கள். உடம்பைக் கொஞ்சம் முன்பக்கம் வளைத்து அல்லது குனிந்து பாருங்கள். வயிற்றைப் பிடித்து மசாஜ் செய்து பார்க்கலாம்.
13. பாட்டி வைத்தியம் ஏதாவது?
(Potty) பாட்டி வைத்தியம் விளக்கெண்ணெய், கடுக்காய்தான்.
14. அறிகுறிகள்?
அரோசிகம் (பசியின்மை, உணவின் மேல் வெறுப்பு), நாக்கு தடிப்பு, தலைவலி, சுறுசுறுப்பின்மை, உப்புசம், தலைவலி, வயிற்று சங்கடம், வயிற்று வலி.

உணவைக் கையில் எடுத்து வாயில் போட்டால் சாப்பிட்டாச்சு என்று அடுத்த முறை சொல்லுவதற்கு முன் வயிற்றைப் பற்றி நினைத்துக்கொள்ளுங்கள். டாய்லெட்டில் சிம்ஃபொனி நிகழ்த்திய ஆனந்தம் ஏற்பட வாய்ப்பிருக்கிறது.

உதவிய புத்தகங்கள்:
1.    GUT – Guila Enders
2.    இப்படிக்கு வயிறுடாக்டர் செல்வராஜன்விகடன் பிரசுரம்
3.    வீட்டு வைத்தியர்டாக்டர் தி.சே.சௌ.ராஜன்சந்தியா பதிப்பகம்


படங்கள்: நன்றி: GUT – Guila Enders புத்தகம்

பிக் டேட்டா – சுஜாதா தேசிகன்

அலுவலகத்தில் இருந்தேன். என் பத்து வயது மகன் தொலைப்பேசினான்.

“சுப்பாண்டி காமிக்ஸ் ஆன்லைனில் ஆர்டர் செய்துவிடு” என்றான்.

“இப்ப மீட்டிங்கில் இருக்கேன்… அப்பறம்.”

ஒரு மணி நேரம் கழித்து மீண்டும் தொலைப்பேசி அழைப்பு.

“என்ன ஆர்டர் செஞ்சாச்சா?”

“ஃபிளிப் கார்ட்டில் இல்லையே…”

”ஐயோ அப்பா… கூகிளில் சுப்பாண்டி என்று தேடு… அமேசான், ஸ்னாப் டீல்… நிறைய வரும் விலையுடன்… எது சீப்போ அதை வாங்கு…”


இந்தச் சம்பவத்துக்கும் ‘பிக் டேட்டா’வுக்கும் தொடர்பு இருக்கிறது. கோயில் கல்வெட்டு பார்த்திருப்பீர்கள். அது ஒரு விதமான தகவல். நம் கணினியில், தாத்தாவின் டைரியில் இருப்பது எல்லாம் தகவல்களே.

உதாரணத்துக்கு உங்கள் தாத்தாவின் டைரியில் நான்கு என்ற குறிப்பைப் பார்க்கிறீர்கள். அது வெறும் எண். அது தகவல் ஆகாது. ஆனால் அதே தகவலுக்கு முன் வேஷ்டி என்று இருந்தால், அது சலவைக் கணக்கு என்று சுலபமாகப் புரிந்துவிடும்.

டைரியை மேலும் திருப்பினால் மீண்டும் நான்கு வேஷ்டி என்று வருகிறது என்று வைத்துக்கொள்ளுங்கள். அதன் மாதம், தேதி, கிழமையைப் பாருங்கள். அதிலிருந்து எதாவது தகவல் கிடைக்கலாம். உதாரணமாக உங்கள் தாத்தா மாதா மாதம் திங்கட்கிழமை நான்கு வேஷ்டி சலவைக்குக் கொடுக்கிறார். அல்லது பதினைந்து நாட்களுக்கு ஒருமுறை சலவைக்காரர் வருகிறார் என்று சிலவற்றை யூகிக்கலாம்.

நான்கு என்பது டேட்டா. அது வேறு ஒன்றோடு தொடர்புப்படுத்தப்படும்போது தகவல் ஆகிறது. இதே டைரி ஆர்.கே.நகரில் கிடைத்தால்? சலவை நோட்டுக்களாக இருக்கலாம்.

மார்ச் 19, 2017 ஹிந்து பத்திரிகையில் ‘Raise in H1N1 cases, but no need to panic’ என்று ஒரு கட்டுரை புள்ளிவிவரத்துடன் வந்தது. இன்று H1N1 பழக்கப்பட்ட பெயராகிவிட்டது. ஆனால் 2009ல் இந்தப் பன்றிக் காய்ச்சல் வந்தபோது உலகமே பதறியது. பலர் உயிரிழந்தார்கள். எங்கே எப்படிப் பரவுகிறது என்று கண்டுபிடிக்க கஷ்டப்பட்டார்கள். இந்த சமயத்தில் ‘நேச்சர்’ (Nature) என்ற அறிவியல் இதழில் கூகிள் ஓர் ஆராய்ச்சிக் கட்டுரை வெளியிட்டது. 2003-2008ல் மக்கள் ‘இருமல், காய்ச்சல்’ என்ற வார்த்தைகளை எப்போது தேடுகிறார்கள், அந்தத் தொடர்பை வைத்துக் காய்ச்சல் எப்போது எங்கெல்லாம் பரவியது என்று கணித்தது. இவர்கள் தேடிய எண்ணிக்கை ஐம்பது மில்லியன் வார்த்தைகள்.

2009ல் H1N1 பரவ ஆரம்பித்தபோது, 450 மில்லியன் தகவல்களைத் தேடி அதிலிருந்து 45 அடிக்கடி தேடும் சொற்களைக் கண்டுபிடித்து, கணித சூத்திரம் கொண்டு எங்கெல்லாம் பரவுகிறது என்று கணித்தது. கூகிள் செய்த விஷயத்துக்கு இன்னொரு பெயர் ‘பிக் டேட்டா.’

டிவிட்டர், ஃபேஸ்புக் மற்றும் பிற சமூக ஊடகங்களில் நீங்கள் பகிரும் ஒவ்வொரு விஷயமும் ஏதோ ஒரு விதத்தில் எங்கோ உபயோகப்படுத்தப்படுகிறது.

மறைந்த முதல்வர் ஜெ.ஜெயலலிதா கடந்த ஆறு மாதங்களில் கூகிளில் எப்படித் தேடப்பட்டார் என்று நீங்கள் பார்க்கலாம். இதில் இன்னும் நுணுக்கமாக திருச்சியில் எவ்வளவு பேர் தேடினார்கள், பெங்களூரில் எவ்வளவு பேர் தேடினார்கள் என்று கண்டுபிடிக்கலாம்.

நீங்கள் முகநூலில் பதிவிடும் ‘குட்மார்னிங்’ மொக்கைகளையும் ஒருவர் கணக்கு எடுத்துக்கொண்டு இருக்கிறார். நாளைக்கே பெங்களூரில் இருப்பவர்கள்தான் அதிகம் மொக்கை போடுகிறார்கள் என்று புள்ளிவிவரத்துடன் வெளியிடப்படலாம். முகநூலில் கோடைக்கால விடுமுறையின்போதும், கிருஸ்துமஸுக்கு முன்பும் நிறைய பேர் ‘Break-up’ என்று பதிவிடுகிறார்கள் என்கிறது இன்னொரு புள்ளிவிவரம். டிவிட்டரில் வரும் டிரெண்ட் எல்லாம் இந்த சமாசாரம்தான்!.

x-x-x-x-x-x

2003ல் தன் தம்பியின் திருமணத்துக்கு விமானம் பிடித்துச் செல்கிறார் Oren Etzioni. திருமணத்துக்கு முன்பே விமான டிக்கெட்டை முன்பதிவு செய்துவிட்டார். விமானத்தில் பயணம் செய்யும்போது பக்கத்தில் இருந்தவரிடம் பேச்சுக் கொடுத்தார். பேச்சுக்கு நடுவில், “நீங்க எப்ப டிக்கெட் புக் செஞ்சீங்க? எவ்வளவு ஆச்சு?” என்ற கேள்விக்கு அவருக்குக் கிடைத்த பதில் ஆத்திரமூட்டியது. பக்கத்தில் இருந்தவர் சமீபத்தில்தான் வாங்கியிருந்தார். வாங்கிய விலை மிகக் குறைச்சல். பக்கத்தில் இருந்த இன்னொருவரிடம் கேட்டார். அவரும் குறைந்த விலையில்தான் வாங்கியிருந்தார். அந்த விமானத்தில் இருந்த பலர் குறைந்த விலையில்தான் டிக்கெட் வாங்கியிருந்தது ஓரனுக்குத் துரோகமாகப் பட்டது. வீட்டுக்கு வந்தபிறகு யோசித்தார்.

விமான டிக்கெட் விலை எல்லாம் பயண வலைத்தளத்திலிருந்து எடுத்து ஆராய்ந்தார். ஏன், எப்போது விலை குறைகிறது என்று தெரியவில்லை. ஆனால் விலை எப்போது, அதிகம் எப்போது கம்மி என்று பன்னிரண்டாயிரம் மாதிரிகளை வைத்து ஒரு நிரல் (ப்ரோக்ராம்) எழுதினார். அந்த நிரல் ‘டிக்கெட் வாங்கலாமா வேண்டாமா’ என்று சொல்லிவிடும். இதற்கு ‘Farecast’ என்று பெயர் சூட்டினார். நீங்கள் உங்கள் பயணத் தேதி, போகும் இடம் ஆகியவற்றைக் கொடுத்தால் “இன்னும் ஒரு வாரம் பொறுங்கள், டிக்கெட் விலை குறைய வாய்ப்பு இருக்கிறது” என்று சொல்லும்.

இதனிடையில், ஓரானுக்கு பிளைட் டேட்டா பேஸில் உள்ள தகவல்கள் கிடைக்க, ஒரு வருடத்தில் 10ஆம் நம்பர் சீட்டுக்கு என்ன விலை என்று கூடத் தெரிந்துவிட்டது. சாதாரண டேட்டாவை புத்திசாலித்தனமாக உபயோகித்தால், பேசும்.

டேட்டா என்றால் வெறும் எண்கள் என்று நினைத்துக்கொண்டு இருக்கிறோம். உங்கள் படம், வீடியோ, நீங்கள் உபயோகிக்கும் மொபைல், நீங்கள் போகும் இடங்கள், நீங்கள் வாங்கும் பொருட்கள் என்று அடுக்கிக்கொண்டே போகலாம். எல்லாமே டேட்டாதான்.

ஒரு உதாரணம் பார்க்கலாம். சென்ற வாரம் திருச்சிக்கு ஆன்லைனில் ரயில் டிக்கெட் புக் செய்தேன். திருச்சிக்குக் கிளம்பிக்கொண்டு இருக்கிறேன். கூகிள் எனக்குத் தகவல் அனுப்பியது, ‘திருச்சியில் நாளை வெய்யில் கொஞ்சம் அதிகம்’ என்று.

உங்களிடம் மொபைல் இருந்தால் உங்கள் பாதை கண்காணிக்கிறது. ஏப்ரல் மாதம் நான் பயணம் செய்த இடங்கள் என்று தேடிய போது கிடைத்த தகவல் இது

போன வருஷம் எங்கெல்லாம் சென்றேன் என்று கூகிளிடம் கேட்டபோது கிடைத்த தகவல், 87 இடங்கள். ஒவ்வொரு இடத்திலும் எவ்வளவு நேரம் இருந்தேன், எந்த சுங்கச்சாவடியில் எவ்வளவு நேரம் வரிசையில் இருந்தேன் என்று எல்லாத் தகவல்களும் கிடைக்கின்றன. இந்த மாதிரி ஒன்று இருக்கிறது என்று உங்கள் மனைவிக்குத் தெரியாமல் பார்த்துக்கொள்ள வேண்டியது உங்கள் பொறுப்பு!

ஆச்சரியம் போதவில்லை என்றால் மேலும் சில விஷயங்கள் இருக்கின்றன. நான் தினமும் அலுவலகம் செல்லும் வழி, சராசரி கிளம்பும் நேரம், திரும்பும் நேரம் முதலியவற்றை கூகிள் குறித்து வைத்துக்கொள்கிறது. அப்போதைய டிராஃபிக் எப்படி இருக்கிறது என்று பார்த்து, “வீட்டுக்கு இப்ப கிளம்பினா கிட்டதட்ட 20 நிமிடம் லேட்டாகும்” போன்ற தகவல்களைத் தருகிறது. மேலும், நான் எந்த சமயம் நடந்தேன், எப்போது காரில் போனேன், எப்போது பைக்கில் போனேன் என்று கூடச் சொல்கிறது!

அமேசானில் ஏதாவது சுயசரிதை அல்லது சிறுகதைத் தொகுப்பை வாங்கினால் சில மணியில் அந்த எழுத்தாளர் எழுதிய வேறு சில புத்தகங்கள் அல்லது மேலும் சில சுயசரிதைகள் உங்களுக்குப் பரிந்துரைக்கப்படுவதைப் பார்த்திருப்பீர்கள்.

கடன் அட்டையில் (credit card) நீங்கள் வாங்கும் பொருட்களைக் கொண்டு ஆணா பெண்ணா, உங்கள் வயது, விருப்பு வெறுப்பு என்று பல விஷயங்களைக் கண்டுபிடிக்கலாம். அமேரிக்காவில் ஒரு டீனேஜ் பெண்ணுக்கு, கர்ப்பிணிகளுக்குத் தேவையான பொருட்கள் வாங்க தள்ளுபடி கூப்பன் அனுப்பியது. அதைப் பார்த்த அவர் அப்பா அந்த கம்பெனியின் மீது புகார் கொடுத்தார். ஆனால் அவருடைய டீன் ஏஜ் பெண் கர்ப்பம் என்று பிறகுதான் அவருக்கு தெரிந்தது. அவருக்கு முன்பே கிரெடிட் கார்ட் கம்பெனிக்குத் தெரிந்திருந்தது.

ஒரு சினிமா தியேட்டரில் நீங்கள் உட்காரும் சீட்டில் சென்சர் பொருத்தினால் மக்கள் எப்படி உட்காருகிறார்கள் என்று கண்டுபிடிக்கலாம். இடைவேளையின்போது எவ்வளவு பேர் எழுந்து போனார்கள், நயந்தாரா வந்தபோது எவ்வளாவு பேர் நெளிந்தார்கள் என்று பல விஷயங்களைக் கண்டுபிடிக்கலாம்.

நாம் தினமும் உபயோகிக்கும் கூகிளில் தப்பாக ஏதாவது டைப் செய்து பாருங்கள். உடனே சரியான வார்த்தையைப் பரிந்துரைக்கும். இது எல்லாம் பிக் டேட்டா சமாசாரங்கள்தான். நீங்கள் தேடும் விஷயத்தில் எத்தனையாவது லிங்கை கிளிக் செய்கிறீர்கள், கிளிக் செய்த இடத்தில் எவ்வளவு நேரம் இருக்கிறீர்கள்… எல்லாம் தகவல்களே!

இன்னும் பத்து வருஷத்தில் இந்தத் துறை எங்கோ செல்லப் போகிறது. உங்கள் டி.என்.ஏ, மருத்துவ ரிப்போர்ட், அதனுடன் செயற்கை நுண்ணறிவு என்று எதை எதையோ செய்யப் போகிறார்கள்.

பாய்ஸ் படத்தில் செந்தில் ஒரு கோயிலுக்குமுன் படுத்திருப்பார். ஓர் இளைஞன் ஜூனியராக வந்து சேர்ந்துகொள்வான். செந்தில் அந்தப் பையனுக்குத் தரும் வேலை – வேளா வேளைக்கு விதவிதமான கோயில் பிரசாதம் வாங்கி வரும் வேலை! அந்த இளைஞன் ‘இது எல்லாம் ஒரு பொழப்பு’ என்று எரிச்சலாகச் சொல்லும்போது செந்தில் சொல்லும் வசனம், “நான் உனக்குத் தருவது சோறு இல்லை, இன்பர்மேஷன். இன்பர்மேஷன் இஸ் வெல்த்” என்பார்.

இன்ஃபர்மேஷன் இஸ் வெல்த். இதுதான் பிக்டேட்டாவின் அடிநாதம்.

நினைவு அலைகள்: ஒரு வரலாற்றுப் பொக்கிஷம் – சுஜாதா தேசிகன்

திருவேங்கிமலை சேஷ செளந்தர ராஜன், TSS Rajan (1880–1953). வடகலை ஐயங்கார். ஸ்ரீரங்கத்தில் வளர்ந்து, சென்னை ராயபுரம் மருத்துவக் கல்லூரியில் மருத்துவம், பிறகு பணி நிமித்தம் ரங்கூனுக்குச் சென்று கஷ்டப்பட்டு, மேல்படிப்புக்காக லண்டன். இந்தியா வந்த பிறகு ஏழைகளுக்கு மருத்துவம், ராஜாஜியுடன் நட்பு, காந்தியுடன் பழக்கம். உப்பு சத்தியாகிரம் – 18 மாதம் சிறை, மந்திரிப் பதவி, விவசாயம் என்ற அவர் வாழ்க்கைப் பயணம் முழுக்க புஃபே சாப்பாடு மாதிரி வரலாற்றுக் குறிப்புகள் பரவிக் கிடக்கின்றன.

“Autobiography is probably the most respectable form of lying” என்பார்கள். பழைய சுயசரிதை என்றால் அதன்  ‘இங்ரெடியண்ட்ஸ்’ என்று நாம் நினைப்பது – கொஞ்சம் பொய், நிறைய சலிப்பு, புரியாத தமிழ். ஆனால் ராஜன் அவர்களின் சுயசரிதை அப்படி இல்லை. இன்று வந்த தினத்தந்தி மாதிரி எல்லோரும் படிக்கக் கூடிய தமிழில் எளிமையாக இருக்கிறது. பொய் கலக்காத அக்மார்க் சுயசரிதை. டைரிக் குறிப்பு போல இல்லாமல்,  ‘நினைவு அலைகளாக’ அவர் அனுபவத்தைக் கொண்டு பல  ‘ஸ்ரீரங்கத்து தேவதைகளை’ உருவாக்க முடியும்! இதுதான் இந்தப் புத்தகத்தின் Unique Selling Point.


ஸ்ரீரங்கத்தில் தன் பள்ளி நாட்களை விவரிக்கும் இடங்களில் ஒரு குழந்தையாக எழுதியிருக்கிறார் ராஜன். வாத்தியார் ஒருவர் அவரை அடித்துக்கொண்டே இருப்பது, வெள்ளைக் கோபுரம் கருப்பாகக் காட்சியளித்தது, அதில் ஒரு பொந்தில் கிளியைப் பார்க்க ஏணி போட்டு பொந்தில் கைவிட, அது கடிக்க, ரத்தம் வந்த அனுபவம். வகுப்பிலிருந்து வந்து கிளியைப் பார்க்க அடிக்கடி “சார் ஒண்ணுக்கு” என்று சாக்கு சொல்லுவது. ஷேசராயர் மண்டபத்தில் இருக்கும் குதிரையின் மீது ஏறி சவாரி செய்து பள்ளிக்குத் தாமதமாகப் போனது என்று ஸ்ரீரங்கத்தை முழுவதும் அனுபவித்திருக்கிறார்.

பள்ளிக்கூடம் என்றால் மேஜை நாற்காலி, பலகை என்று நினைப்போம். ராஜன் படித்த காலத்தில் மணல் மீது உட்கார்ந்து, மணல் மீது எழுதும் பள்ளிக்கூடம். சித்திரைத் தேர் மீது ஏறும் படிக்கட்டுக்குக் கீழே நிழலாக இருக்கும் இடம்தான் பள்ளிக்கூடமாம்.

நூறு வருடத்துக்கு முன்பே ஸ்ரீரங்கம் வைகுண்ட ஏகாதசிக்குப் பலர் கடைவிரித்திருக்கிறார்கள். பட்டாணியும் வேர்க்கடலையும் வறுக்கும் வாசனை ராஜனைச் சுண்டி இழுக்க பட்டாணிக் கடையைச் சுற்றிசுற்றி வந்திருக்கிறார். வீட்டிலிருந்து பாட்டிக்குத் தெரியாமல் நெருப்பும் தண்ணீரும் கொடுத்து பட்டாணிக்காரருக்கு உதவி செய்தும் ஒரு பிடி பட்டாணி கூடக் கிடைக்கவில்லையாம். வீட்டில் கேட்டால் வாங்கித் தர மாட்டார்களாம். ஏன் என்ற காரணத்தை இப்படிக் கூறுகிறார்.

“ஸ்ரீரங்கம் பிராமணர்கள் பெருத்த ஊர். பூணூல் போடாத சிறுவர்களும், கல்யாணமாகாத சிறுமிகளுமே வறுத்த பட்டாணியை வாங்கலாம். மற்றவர்கள் வாங்க மாட்டார்கள். வைதீகம் பழுத்த வீடுகளில் பட்டாணியைத் தொடமாட்டார்கள்.”

கடைசியில் அவர் பட்டாணி எப்படிச் சாப்பிட்டார் என்ற சுவாரசியமான கதை புத்தகத்தில் உள்ளது.

ராஜன் குடும்பம் ஏழ்மையில் இருந்திருக்கிறது. அஹோபில மடத்தில் இரண்டு அறைகளில் வாடகை இல்லாமல் குடித்தனம் நடத்தியிருக்கிறார்கள். புரட்டாசி உற்சவத்தின்போது அஹோபில மடத்தில் இருக்கும் ஸ்வாமி தேசிகன் வெளியே வரக் கூடாது என்ற நீதிமன்ற உத்திரவு பற்றிக் குறிப்பிடும் ராஜன், யாரோ ஒரு வெள்ளைக்காரத் துரை சொன்ன தீர்ப்பை வேதவாக்காக எடுத்துக்கொண்டு இரு கலையாரும் கட்டுப்படுவது வேடிக்கை என்கிறார்.

“ஸ்ரீவைஷ்ணவ ஆசாரியப் பரம்பரையில் இருகலையார்களும் இருந்திருக்கிறார்கள். இவ்வளவு ஒற்றுமை இருந்தும் ஸ்ரீரங்கம், காஞ்சிபுரம் போன்ற பெரிய விஷ்ணு ஷேத்திரங்களில் இரு கூட்டத்தினருக்கும் விவாதம் ஓயாமல், நீதிமன்றத்து நடவடிக்கைகள், கிரிமினல் வழக்குகள், சிவில் வழக்குகள்… வக்கீல்களுக்கும் இதனால் நல்ல வருமானம். கோர்ட்டுகளுக்கு வேலையும் வருமானமும். கட்சிக்காரர்களுக்குப் பொய்ச்சாட்சிகள்… வைஷ்ணவ மதமோ கொள்கையோ, இந்து மதமோ ஆசாரமோ இன்னதென்று கனவு காண்பது கூட இல்லாத… முஸ்லீம், கிறிஸ்துவ நீதிபதிகளிடத்து நியாயம் கோருவதற்கும் பின்வாங்கமாட்டார்கள். இந்த கோஷ்டிச் சண்டைகளில் பெரும்பாலோர் பழையகாலத்து மடிசஞ்சிகள்.”

புரட்டாசி உற்சவத்தில் கிடைக்கும் புளியோதரைக்காக இரண்டு மணி நேர ‘சேவா காலத்’தையும் கேட்டுக்கொண்டு இருந்திருக்கிறார். அதேபோலக் கோயிலில் கிடைக்கும் தோசை, வடை பிரசாதத்துக்கு ஆசைப்பட்டு, ஆழ்வார், ஆசாரியர்களை தோளில் தாங்கும் ‘ஸ்ரீபாதம் தாங்குவார்’1 ஆக (ஸ்ரீபாதம் தாங்குவாருக்கு உத்தரவாதமாக தீர்த்தம், பிரசாதம் கிடைக்கும்!) இருந்திருக்கிறார்.  அதனால் இவரை ‘ஆழ்வார் தூக்கி’ என்று பள்ளியில் ஏளனம் செய்திருக்கிறார்கள்.

ஒரு இடத்தில் அவர் தனக்கு “நல்ல தமிழ் அறிவு பெருப்பாலும் இளவயதில் பாசுரங்களைக் கேட்ட பழக்கத்தினால் உண்டானது” என்கிறார். எழுத்தாளர் சுஜாதாவும் இதையே சொல்லியிருக்கிறார். தமிழை வளர்ப்பதற்குப் பக்தி இலக்கியம்தான் சரியான வழி என்று தோன்றுகிறது.

‘குமாஸ்தாவாக ஆனால் போதும்’ என்று இவர் அப்பா சொல்ல, இவரோ சென்னை ராயபுரம் மருத்துவக் கல்லூரியில் சேர்ந்து,  ‘ராக்கிங்’ அனுபவித்திருக்கிறார். ‘ராக்கிங்’ நூற்றாண்டுக்கு முன்பே இருந்திருக்கிறது என்றும், இன்றும் தொடர்கிறது என்றும் தெரிகிறது. வெள்ளைக்காரர்களால் நம் நாட்டுக்கு வந்த இன்னொரு கெட்ட விஷயம் இது.

மருத்துவப்படிப்பு முடித்த பின் அரசாங்கக் கடனை அடைக்க ரங்கூனுக்கு (பர்மா) மனைவி குழந்தைகளுடன் சென்று, அங்கே மருத்துவமனையில் பலர் சாகக் கிடக்கும் இடத்தில்  “இன்னிக்கு எவ்வளவு பேர் செத்தார்கள்?” என்று கணக்குப் பார்க்கும் வேலை. மலம், மூத்திரம் போவதற்கு வசதியாக ஓட்டை போட்ட மரக் கட்டிலில் படுத்துக்கொண்டு இன்னிக்கோ நாளைக்கோ என்று இருக்கும் நோயாளிகள் கீழே மலமும் மூத்திரமும் ஓடிக்கொண்டு இருக்க… என்று விவரிக்கும் இடங்கள் எல்லாம் நம்மைக் கலங்க செய்கின்றன.

தன் கல்யாணம் வெகு விமர்சையாக நடக்கவேண்டும் என்று கனவு காண்கிறார். தினமும் பெண் வீட்டுக்குமுன் பந்தல் போடுகிறார்களா என்று பார்த்துக்கொண்டு இருக்க, பெண் வீட்டாரோ கல்யாணத்துக்கு ஒருநாள் முன்பு கூடப் பந்தல் போடவில்லையாம். பெண் வீட்டுக்குச் சென்றபோது ‘யார், மாப்பிளையா?’ என்று தூக்கக் கலத்துடன் இவரை வரவேற்றிருக்கிறார்கள். பெண் லட்சணமாக இருந்தது மட்டும்தான் ஒரே ஆறுதல்!

மருத்துவ மேல்படிப்புக்கு லண்டனுக்குக் கப்பல் பயணம், கிடைத்த நண்பர்கள், சாப்பாடு என்று பயணக் குறிப்புக்களை மிக விரிவாக எழுதியுள்ளார்.

சைவம் என்பதால் இவர் கப்பலில் அதிகம் சாப்பிடவில்லை. கிட்டதட்ட உண்ணாவிரதம் இருந்திருக்கிறார். தற்போது உண்ணாவிரத மகிமையைப் பலர் எழுதுகிறார்கள் ஆனால் 1947ல் அதுவும் மருத்துவராக இவர் எழுதியிருப்பது மிகுந்த நம்பிக்கையைத் தந்தது.

“மனிதன் உடல் வளர்ப்பதற்காகத் தேவையான உணவு மிகவும் சொற்பம். அரசனாக இருந்தாலும், ஆண்டியாக இருந்தாலும் சற்றேறக்குறைய ஒரே அளவுதான் உண்ணக்கூடும். பொருள் உடையவன் பல வகைப்பட்ட உணவை அடிக்கடி சாப்பிட்டபோதிலும் அது நாவிற்கு மட்டிலும் ருசிப் பழக்கம் அதிகரிப்பதைத் தவிர வேறு குணம் இல்லை. உண்ணாவிரதம் இருப்பது மனிதர்களுக்கு ஏற்பட்ட பழக்கங்களில் ஒன்று. அது மதக் கோட்பாடு, அநுஷ்டானம் இவைகளையொட்டிக் கையாளப்பட்டு வருகின்றது. பட்டினி சுக வாழ்வு தரும் என்பதை இன்னும் உலகம் அறியவில்லை. வியாதியின் நிமித்தம் மருத்துவர்கள் உணவைக் குறைத்து வைத்தியம் செய்வது எல்லோருக்கும் தெரிந்ததுதான். உடல் உழைப்பு அதிகமின்றி மூளை வேலை அதிகம் உள்ளவர்களுக்குக் குறைந்த உணவு தேக ஆரோக்கியத்தை நிலை நிறுத்துவதோடு, மற்ற நோய்கள் வராமலும் பாதுகாக்கும்.”

லண்டனில் தெருக்கள் குப்பையாகவும், எல்லோரும் எச்சில் துப்பிக்கொண்டும் இருந்தார்கள் என்று அவர் சொல்லும்போது ஆச்சரியமாக இருக்கிறது. லண்டனில்  ‘கறுப்பர்கள்’ நடத்தப்பட்ட விதம் பற்றியும் எழுதியுள்ளார். ஓர் ஆங்கிலேயத் தம்பதியின் நட்பு கிடைக்கிறது. பரஸ்பரம் உதவி செய்துகொள்கிறார்கள்.

திரும்பி இந்தியா கிளம்பும் முன் அந்த ஆங்கிலப் பெண்  “எனக்குக் கல்யாணம் ஆகாமல் நீங்களும் தனியாளாக இருந்தால் உங்களைத்தான் கல்யாணம் செய்துகொண்டிருப்பேன்” என்று சொன்ன பகுதிகள் ரசமானவை. இந்திய விடுதியில் நடக்கும் ரகசியக் கூட்டம் ‘ஹேராம்’ படத்தின் சில காட்சிகளை நினைவுபடுத்தியது.

இந்தியா வந்த பிறகு ‘கடல் தாண்டி’ சென்ற காரணத்துக்காக இவரை ஜாதிப் பிரஷ்டம் செய்து, பிராம்மண்யத்தை இழந்துவிட்டார் என்று கூறுகிறது ஐயங்கார் சமூகம்.

“என் சுற்றத்தார், உறவினர்,பெற்றோர்கள் உட்பட யாரும் என்னைத் தங்கள் வீட்டிற்கு அழைக்கவோ நான் தங்கியிருக்கும் இடம் வந்து என்னுடன் உண்டு களிக்கவோ மனம் துணியவில்லை. எங்கே தங்களையும் ஜாதியை விட்டு ஊரார் நீக்கிவிடுவார்களோ என்ற பயம். வந்து பார்த்துப் பேசிவிட்டுப் போவதோடு நின்றுவிட்டார்கள். எனக்கு என்ன செய்வதென்று விளங்கவில்லை” என்று தன் கொடுமையான அனுபவத்தை விவரிக்கிறார்.

இன்று ஸ்ரீரங்கத்தில் வீட்டுக்கு ஒருவர் அமெரிக்காவிலோ, சிங்கப்பூரிலோ, லண்டனிலோ இருக்கிறார்கள். ஜீயர், அரையர் வீட்டில் கூடப் பலர் வெளிநாட்டுக்குச் சென்றுவிட்டார்கள். ஏன், பெருமாளே கூட பிட்ஸ்பர்க் பார்த்துவிட்டார்.

அந்தக் காலத்தில் பரண்யாசம்2 செய்துகொள்ள வேண்டும் என்றால் ஜீயரைச் சேவித்துக்கொண்டே இருக்க வேண்டும் என்ற தகவல் எனக்கு புதுசு. ராஜன் அவர்களின் அப்பா அஹோபில ஜீயரிடம் தனக்கு பரண்யாசம் செய்துகொள்ள விண்ணப்பிக்க, “உன் மகன் கடல் தாண்டிவிட்டான், நீயும் உன் மகனுடன் சேர்ந்து இருக்கிறாய்” என்று ஜீயர் மறுத்துவிட, ராஜனின் அப்பா ஜீயரைக் கண்டபடித் திட்டிப் பேசிவிட்டு வந்துவிடும் இடங்கள் ஆச்சரியமானவை.

ஒதுக்கிவைத்த காலகட்டத்தில் இவர் பெண்ணுக்குத் திருமணம் செய்ய முற்படுகிறார். ஆனால் வாத்தியார், சமையல் செய்பவர் யாரும் கிடைக்கவில்லை. பணம் அதிகம் கொடுத்து ஏற்பாடு செய்கிறார். இவர் வீட்டுக்கு வந்த வாத்தியார் பிரம்மாவுக்கு ‘லண்டன் பிரம்மா’ என்ற பட்டப்பெயர் கிடைக்கிறது; சமையல் செய்ய வந்தவருக்கு ‘லண்டன் சண்முகம்’ என்ற பெயர். இவர் உதவியால் சித்திரை தெருவுக்கு வந்த புது வேதாந்த தேசிகனுக்கு ‘லண்டன் தேசிகன்’ என்ற திருநாமம்!

எந்தக் காலத்திலேயும் மாமியார், மருமகள் மனஸ்தாபம் இருந்திருக்கிறது. கணக்கு ராமானுஜன் வாழ்கையிலும் இதைப் பார்க்கலாம். ராஜன் அதை முழுக்க விவரிக்காவிட்டாலும், சில இடங்களில் தெரிகிறது. ராஜனின் பெண் கல்யாணத்துக்கு அவருடைய சொந்த அம்மாவே வராததற்குக் காரணம் ‘தன் மனைவி மீது இருந்த பொறாமை’ என்கிறார்.

‘கலிகால அயோத்தி’ என்ற அத்தியாயம் முழுவதும் இவர் அயோத்திக்குச் சென்ற யாத்திரை பற்றி எழுதியிருக்கிறார். சில விஷயங்கள் மிகத் தைரியமாக சொல்லுகிறார் உதாரணத்துக்கு ஒரு பகுதி:

“அயோத்தியில் அவசியம் தரிசிக்கவேண்டிய இடம் ராம ஜனன ஸ்தானம். ..பிற்பகல் அங்கே சென்றேன். …ராமன் அவதாரம் செய்த ஸ்தலத்தைத் தரிசிக்க வேண்டியது எனது கடமை என நினைத்து. …ஊருக்கு வெளியே சுமார் ஒரு மைல் தூரம் சென்றதும் ஒரு மசூதி தென்பட்டது. அதைக் கடந்து சென்று அதன் பின்புறத்தில் பத்தடிச் சதுரமுள்ள ஒரு சிறு கட்டடத்தைப் பார்த்தேன். அந்த அறையின் தளம் பூமி மட்டத்திற்குக் கீழே இறக்கிக் கட்டப்பட்டு இருள் மண்டிக் கிடந்தது. …இந்த அற்பமான இருட்டில்தான் தசரதச் சக்கரவர்த்தியின் மனைவி ராமனை ஈன்றெடுத்து வளர்த்திருப்பாள்? பார்ப்பவர் நகைக்கும்படியான ஓர் இடத்தில்… என்னை அறியாமலே என் கண்களில் நீர் ததும்பியது. …ஒவ்வொரு நூற்றாண்டிலும் நமது நாட்டில், நமது மதத்தில் பிறந்து வளர்ந்துவந்த நம் சகோதரர்களைக் கோடிக்கணக்காக வேறு மதத்திற்குப் புகச் செய்து இழந்தோம். இழந்தது மட்டுமல்லாமல், அவர்களே நம் கோயில்களையும், புண்ணிய க்ஷேத்திரங்களையும், தெய்வங்களையும் ஹதம் செய்ய, நாம் பயந்து வாளா இருந்து வந்திருக்கிறோம். வட இந்தியாவில் எங்கே சென்று பார்த்தாலும், நம் புனித ஸ்தலங்கள் இடிக்கப்பட்டு, பாழாக்கப்பட்டு, அந்த இடத்திலேயே மசூதிகள் கட்டப்பட்டு…
இவ்வளவு கொடுமைக்கு ஆளாகியும், நாம் துவேஷம் கொள்ளாமல் கூடியமட்டும் சேர்ந்து வாழ்ந்துவருகிறோம்.

ஹிந்து முஸ்லிம் ஒற்றுமை நாட்டிற்கு அவசியம். அதற்காக எவ்வளவு விட்டுக்கொடுக்கமுடியுமோ அவ்வளவு விட்டுக்கொடுக்க வேண்டியதும் நமது கடமை. இருந்தபோதிலும் நம் நாட்டினர் அநுபவித்திருக்கும் இன்னல்களையும் அவமானங்களையும் பார்க்கும்பொழுது மனம் வாடாமல் இருக்க முடியாது…”

இவர் மருத்துவமனையை காந்தி திறந்துவைக்கும் முன் காந்திக்கு ஏற்பட்ட நெருக்கடி, ஆனால் காந்தி ‘வாக்கு கொடுத்துவிட்டேன்’ என்று திறந்து வைத்த சம்பவம், ஹரிஜன ஆலயப் பிரவேசத்திற்குத் தலைமை தாங்கி அதனால் இவருக்கும் பிராமண சமூகத்துக்கும் ஏற்பட்ட பிரச்சினைகள், காங்கிரஸ், அரசியல், மந்திரிப் பதவி, சட்டசபை அனுபவங்கள், தன் முதல் மகளுக்குக் கல்யாணம் செய்தபின்பு, தனக்கு ஓர் ஆண் குழந்தையை பிரசவித்துவிட்டு மனைவி இறந்துவிட, சில மாதம் கழித்து ஆண் குழந்தையும் இறந்து… இவ்வளவும் ஒருவர் வாழ்கையில் நடந்திருக்கிறது என்று படிக்கும்போது பிரமிப்பே மிஞ்சுகிறது. தம் மனசாட்சிக்கு எது சரியோ அதைச் செய்திருக்கிறார் ராஜன்.

கடைசியாக இவர் அரசியலுக்கு முழுக்கு போட்டுவிட்டு, எதுவும் வேண்டாம் என்று கிராமத்தில் விவசாயம் செய்ய முற்படுகிறார்

“பிரபல வைத்தியனாக இருந்து காங்கிரஸில் ஈட்டுப்பட்டு சத்தியாக்கிரகம் செய்து, தீண்டாமையை ஒழிக்கப் பன்முறை சிறை சென்ற, அரசாங்க மந்திரியாகச் சிலகாலம் உத்தியோகம் வகித்த நான், முதுமைப் பருவத்தில் என்னை விவசாயியாக எண்ணி இந்தக் கிராமத்தில் வாழ்வதற்குப் போய்ச் சேர்ந்தது ஒரு பெரிய விந்தை. எனது வரவை உத்ஸாகத்தோடு கிராமவாசிகள் வரவேற்கவில்லை… அந்த ஊர் வேசிகளுக்குக் கூட என்னிடம் நன்மதிப்பு இல்லை…”

உப்புச் சத்தியாகிரகத்தில் ஈட்டுப்பட்டுச் சிறையில் இருந்த அனுபவம் திரைப்படக் காட்சிகளுக்கு நிகரானவை.

“கோயம்புத்தூர் மத்தியச் சிறையின் கிணற்றுத் தண்ணீர் மருந்து குடிப்பதைப் போல இருக்கும். அந்த தண்ணீரைக் குடித்துப் பழகுவதற்கு எனக்கு ஒரு வாரத்துக்கு மேல் ஆயிற்று. நான் இரவில் தாகத்திற்காகக் குடிப்பதற்கு நல்ல தண்ணீரென்று எண்ணி அந்த ஜெயில் தண்ணீரை எனது அலுமினியம் கூஜாவில் நிரப்பிவைப்பது வழக்கம். பாதி ராத்திரிக்குப் பிறகு அந்தக் கூஜா சொம்பிற்குள் வெடிக்கும் சப்தம் கேட்கும். விடியும் வரையில் பத்து நிமிஷத்துக்கு ஒரு தடவையாகச் சிறு வெடிச் சத்தம் கேட்டுக்கொண்டிருக்கும்…”

அந்தத் தண்ணீரில் அப்படி என்ன விசேஷம் என்று தெரிந்துகொள்ள புத்தகம் வாங்கிப் படியுங்கள்.

கல்கி முன்னுரையில், “மனைவியை அழைத்துக்கொண்டு சர்க்கார் கடனைக் கழிக்கப் பர்மாவுக்குச் சென்றார். நானும் அவருடன் கூடச் சென்றேன். …மேலதிகாரியின் மேல் கண்ணாடிக் குவளையையும் தர்மாமீட்டரையும் வீசி எறிந்தார். நானும் பக்கத்திலிருந்த கண்ணாடி வெயிட்டைத் தூக்கி எறிந்தேன். மாஜிஸ்திரேட் அவரை ‘வெறும் சப்ஆஸிஸ்டெண்ட் சர்ஜன்’ என்று சொன்னபோது அவருக்கு வந்த ஆத்திரத்தைவிட எனக்கு அதிகம் வந்தது… அவர் கப்பலில் ஏறினபோது நானும் டிக்கெட் இல்லாமல் ஏறிவிட்டேன்.”

ராஜன் அவர்கள் வாழ்ந்த இல்லம் இன்னும் திருச்சியில் இருக்கிறது. அடுத்த முறை திருச்சி சென்றால் நிச்சயம் பார்த்துவிட்டு வாருங்கள்.

—-
நினைவு அலைகள்
சந்தியா பதிப்பகம்
சென்னை
முதற்பபதிப்பு – 1947
விலை ரூ225/
—-
அடிக்குறிப்பு:

1. ஸ்ரீபாதம் தாங்குவார் –   பல்லக்கில் பெருமாளைத் தோளில் தாங்கி வருபவர்களை “ஸ்ரீபாதம் தாங்குவார்” என்று அழைப்பர்.
2. பரண்யாசம் – வடகலைப் பிரிவினரின் சரணாகதி சம்பிரதாயம்.

கேமரா கனவுகள் – சுஜாதா தேசிகன்

அப்பாவின் திருமண ஆல்பத்தை நான் பார்த்ததில்லை. காசி யாத்திரை மை கன்னத்துடன் எப்படி இருந்திருப்பார் என்று யோசித்ததுண்டு.

“கல்யாணத்தின்போது ஏதோ சச்சரவு. அதனால் புகைப்படம் ஒன்று கூடக் கிடையாது” என்றார். ஒரே ஒரு புகைப்படம் பீரோவில் இருந்தது. அதில் அப்பாவின் முதுகு மட்டும் தெரிந்தது. அம்மாவை முழுசாக யாரோ மறைத்துக்கொண்டு இருந்தார்கள்.
இதனாலோ என்னவோ, அப்பாவிற்கு கேமராவில் படம் எடுப்பதும், போட்டோவிற்கு போஸ் கொடுப்பதும் மிகவும் விருப்பம். எங்களைத் தன் கேமராவில் படங்களாக எடுத்துத் தள்ளினார். என்னுடைய சிறுவயதுப் படங்கள் கருப்பு வெள்ளையில் எல்லாம் கொள்ளை அழகு. பொதுவாகக் குழந்தைகள் அழகாக இருக்கும்.
கடந்த நாற்பது வருடங்களாகப் பல கேமராக்கள் என்னுடன் பயணம் செய்திருக்கின்றன. நான் முதன்முதலில் உபயோகித்த கேமராவை இன்று செல்ஃபி எடுக்கும் கேமராவுடன் ஒப்பிட்டால் அது சரியான  ‘டப்பா கேமரா’ என்றுதான் சொல்ல வேண்டும். நிஜமாகவே ‘டப்பா கேமரா’தான்.

பள்ளியில் அறிவியல் பாடம் படிக்கும்போது ஊசித்துளைக் கேமரா (Pinhole Camera) செய்து, அதில் தலைகீழாக மரங்களைப் பார்த்திருக்கிறேன். என் அப்பாவுடன் இருந்த கேமராவும் அதேபோலத்தான் இருக்கும். அதன் பெயர் ‘Brownie Hawkeye Flash Model Camera’. 1950ல் கோடாக் நிறுவனம் இந்த கேமராவை அறிமுகம் செய்தது. விலை அதிகம் என்று அப்பா ஃபிளாஷ் வாங்கவில்லை. ஆங்கிலத் திரைப்படம் ஒன்றில் பிளாஷ் அடித்து அந்த பல்பிலிருந்து புகை வந்த போது பிளாஷ் இப்படித்தான் இருக்கும் என்று யூகித்தேன்.

அந்த கேமராவில் படம் எடுக்க நிறைய பிரயத்தனம் செய்ய வேண்டும். ஃபிலிம் சுருளைப் பொருத்த திருச்சி மேலபுலிவார் சாலையில் (West Boulevard Road என்பதின் தமிழாக்கமே மேலபுலிவார் சாலை!) இருக்கும்

OR
WO

என்று பெரிதாக எழுதியிருக்கும் கடையில் கொடுத்தால், இருட்டு அறையில் ஃபிலிமை பொருத்தித் தருவார்கள்.

கேமரா பின்புறம் சின்ன துவாரத்தில் சிகப்பாக ‘1’ என்று முதல் படம் எடுக்கத் தயாராகும். மொத்தமே 12 படம்தான் எடுக்க முடியும். ஒவ்வொரு படமும் யோசித்து எடுக்கவேண்டும்.

ஒரு படம் எடுத்த பின் ஸ்லோ மோஷனில் மெதுவாக கேமரா சைடில் இருக்கும் சக்கரத்தை பின்புறம் ‘2’ என்ற எண் வரும் வரை சுற்ற வேண்டும். அதிகமாகச் சுற்றினால் ‘3’ வந்துவிடும். இது ஒன்வே டிராபிக் மாதிரி. மீண்டும் ‘2’ கொண்டு வர முடியாது.

அது மட்டும் இல்லை, படம் எடுக்க நல்ல வெயில் இருக்க வேண்டும். நல்ல வெயில் என்றால் காலை அல்லது மாலை வெயில். உச்சி வெயில் எல்லாம் சரிப்படாது.

“வாடா வெயில் போய்விடப் போகிறது” என்று எங்களை நிற்கவைத்து பின்னாடி பெட்ஷீட் கொண்டு பேக்ரவுண்ட் அமைத்து, கொஞ்சம் ரைட்… கொஞ்சம் லெப்ட்” என்று கார் பார்க்கிங் செய்வது போல அப்பா கேமராவை வயிற்றுக்குக் கீழே வைத்து அதன் தலைப்பகுதியில் இருக்கும் ‘சோடா புட்டி’ கண்ணாடியில் நாங்கள் முழுசாகத் தெரிந்த பின்னர், “கண்ணை மூடாதே… 1…2…3” என்று, மெதுவடையை மெதுவாக எண்ணெய்யில் போட்டுக் கையை எடுப்பது மாதிரி, கிளிக் செய்து மெதுவாகக் கையை எடுப்பார்.

படம் எடுத்த பின் கேமரா மேலபுலிவார் சாலையில் இருக்கும் கடையில் மீண்டும் டார்க் ரூம் செல்லும். பிரசவ வார்ட் முன் காத்திருப்பது போலக் காத்திருக்க வேண்டும். வெளியே வந்து “ஒரு வாரம் ஆகும்” என்பார்கள்.

ஒரு வாரம் சஸ்பென்ஸுக்குப் பின் 12 படத்தில் ஐந்து அல்லது ஆறு படங்கள் நன்றாக வந்திருக்கும். கூடவே நெகட்டிவ் என்ற ஒரு வஸ்துவை கவரில் கொடுப்பார். (பிலிம் சுற்றப்பட்ட குழலை நான் வாங்கிக்கொண்டு வந்து பட்டம் விடும் நூல் சுற்ற உபயோகித்தேன் என்பது கொசுறு தகவல்.)

“ஏன் மற்ற படங்கள் சரியாக வரலை? இத்தனக்கும் வெயில் கூட நல்லாதான் இருந்தது” என்ற கேள்விக்கு “ஓவர் எக்ஸ்போஸ் ரொம்ப வெயில்” என்பது பதிலாக இருக்கும்.

இந்த கேமராவை வைத்துக்கொண்டு நிறைய விளையாடியிருக்கிறேன். படம் எப்படி டெவலப் செய்கிறார்கள் என்று பார்க்க வாயில் நுழையாத hydroquinone போன்ற சில ரசாயன கலவைகளை வாங்கி, மாடி அறையை இருட்டாக்கி, சிகப்பு பல்ப் ஒளிர, கொடி ஒன்றில் கிளிப்பில் சில படங்கள் தொங்க, தமிழ் சினிமாவில் ரகசியமாக விஜயகாந்த் டெவலப் செய்வது போலச் செய்து பார்த்திருக்கிறேன். பல முறை முயன்றும் எனக்குச் சரியாக வந்ததில்லை. ஒரே ஒருமுறை கலவையில் பிலிம் கலங்கலாக, பிறகு அதிலிருந்து படம் வந்ததைப் பார்த்து ஏதோ பெரிய சாதனையாக எண்ணினேன். படிப்பு சரியாக வரவில்லை என்றால் கேமரா மேன் ஆகிவிடலாம். பலருக்கு பிலிம் பிரிண்ட் போட்டுச் சம்பாதித்துவிடலாம் என்ற திட்டம் கூட இருந்தது.

பள்ளியில் மார்ச் மாதம் வருடாந்திரத் தேர்வுக்கு முன்பு முக்காடு போட்டுக்கொண்டு ஒரு பிளேட் எடுத்துவிட்டு திரும்பப் போட்டுவிடும் பெரிய கேமராக்களிலும், டெல்லி அப்பளம் விற்கும் கண்காட்சிகளில் தாஜ் மஹால் ஸ்கிரீன் முன்பும் படம் எடுத்துக்கொண்டவை எல்லாம் எப்படி அழகாக வருகின்றன என்று யோசித்திருக்கிறேன்.

சில வருடங்களுக்குப் பிறகு 1985ல் ‘Hot shot 110s’ என்று பென்சில் பாக்ஸ் சைசில் கேமரா புரட்சி நடந்தது. 350 ரூபாய்க்கு வாங்கினேன். பின்புறம் திறந்து காட்ரிட்ஜ் உருவில் இருக்கும் பிலிமை நாமே பொருத்தலாம். முக்கியமான விஷயம் கலர் படம்!

படம் எடுத்தபின்தான் அடுத்த படத்துக்கு ‘சர சர’ என்று நகர்த்தலாம். இந்த கேமரா வந்த சமயம் சக்கூரா, கோனிக்கா (சக்கூரா, கோனிக்கா என்று வாய்விட்டு மூன்று நான்கு மாத்திரைகளாக இழுத்து சத்தமாகச் சொன்னால் பழைய விளம்பரம் ஞாபகத்துக்கு வரலாம்), கோடாக், ஃபூஜி என்று பல விதமான பிலிம் சுருள்கள் வந்தன. இந்து, அக்ஃபா போன்றவை காணாமல் போயின. பல இடங்களில் கலர் லேப் முளைக்கத் தொடங்கியது. லாட்டரிச் சீட்டுக் கடையில் ரஜினி படம் மாதிரி கலர் லேப்களில் வானவில் படங்களுடன் கட்சி தந்தது.

ஹாட் ஸ்பாட் கேமரா கொண்டு படம் எடுப்பது மிகச் சுலபமாக இருந்தது. படம் எடுத்த பின் ஜங்ஷனில் இருக்கும் சித்ரா கலர் லேப்பில் இருந்த பெரிய வெள்ளை ஜெராக்ஸ் மிஷின் போன்ற ஒன்று, சில மணிநேரத்தில் சொரசொரப்பான மேட் அல்லது பளபளக்கும் கிளாஸி ஃபினிஷ் என்று படங்களைத் துப்பியது. இலவசமாக பிளாஸ்டிக் ஆல்பத்துடன் படங்கள் எல்லாம் சுடச்சுட ஜில்லென்று இருக்கும்.

நிலாவைக் கையில் பிடிப்பது போல, கைமேல் நிற்பது போல என்று பல டிரிக் ஷாட் எடுத்திருக்கிறேன். இந்த கேமராவிலும் சில பிரச்சினைகள் இருந்தன. படம் நன்றாக இருக்கும், ஆனால் ஓரத்தில் இருந்தவர் அதில் இருக்க மாட்டார் . நடுவில் இருந்தவருக்குத் தலை இருக்காது. ஃபோகல் லென்த் பற்றி எதுவும் தெரியாத அந்தக் காலத்தில் எடுத்த பூ, பூச்சி எல்லாம் குத்துமதிப்பாக விழுந்தன.

சில வருடங்களில் இந்த காமரா போய் 35mm கேமரா வந்தது. வெளிநாடு சென்று வந்த என் உறவினர் ஒருவர் எங்களுக்கு வாங்கி வந்தார். ‘மேட் இன் ஜப்பான்’ – யாஷிக்கா ஆட்டோ ஃபோகஸ் கேமரா.

கேமரா முகப்பில் சிவனுக்கு இருப்பது போல மூன்று கண்களுடன் சென்சார் சமாசாரமும். உள்ளே ஃபிலிம் சுருளை தட்டையாக வைக்க வேண்டும் குறிப்புடன் கேமரா வித்தியாசமாக இருந்தது.

பிலிம் சுருளை உள்ளே வைத்து மூடியவுடன் சமத்தாக ‘கிர்’ என்ற சத்ததுடன் தானாகச் சுற்றிக்கொள்ளும்போது ஜப்பான்காரன் மீது காதலே வந்தது.

படம் எடுத்த பிறகு அடுத்த படத்துக்கு அதுவே சென்றுவிடும். ‘செல்ப் டைமர்’ என்ற ஓர் ஆச்சரியம்தான். முதல் செல்ஃபி இங்கிருந்துதான் ஆரம்பம். சின்னதாக ஒரு சிகப்பு லைட் 10 முறை கண்சிமிட்டிப் படம் எடுப்பதற்குள் ஓடிச்சென்று மற்றவர்களுடன் சேர்ந்துகொள்ளலாம். எடுக்கும் தேதி, நேரம் எடுக்கும் படத்திலேயும் பிரிண்ட் ஆகும் அதிசயமும் நடந்தது.

இதில் எடுத்த படங்கள் எல்லாம் மிக அருமையாக வந்தன. குறிப்பாக இயற்கைக் காட்சிகள். அதுவே ஏதோ கலர் எல்லாம் கொடுத்து வித்தை காண்பித்தது. திருச்சி மலைக்கோட்டை, காவிரி, ஸ்ரீரங்கம் என்று பல இடங்களுக்கு இதனுடன் சுற்றியிருக்கிறேன். அப்பாவுடன் ஒருமுறை மும்பைக்குச் சென்றபோது தாஜ் ஹோட்டலைப் படம் எடுத்தேன். அதை பிரிண்ட் செய்த போது ‘போஸ்ட் கார்ட் மாதிரியே இருக்கு’ என்று பலர் பாராட்டினார்கள். ஒரே பிரச்சினை இதன் பேட்டரிதான். 2CR5 என்று ஒட்டிப் பிறந்த குழந்தை மாதிரி இருக்கும். சுலபத்தில் கிடைக்காது. பர்மா பஜார் போன்ற கடைகளில் சொல்லிவைத்து வாங்கவேண்டும். விலையும் மிக அதிகம். 35mm பிலிம் இருக்கும் சின்ன பிளாஸ்டிக் டப்பா ஸ்ரீசூர்ணம் போட்டு வைத்துக்கொள்ளப் பயன்பட்டது.

வேலைக்குச் சேர்ந்து அமெரிக்கா சென்றபோது அங்கேயும் கேமரா ஆசை விடவில்லை. டாலரில் சேமித்த பணத்தைக் கொண்டு கேனன் எஸ்.எல்.ஆர். ஒன்று வாங்கினேன். எல்லோரையும் போல பக்கத்துவீட்டுச் சிகப்பு கார் முன்பு படம் எடுத்துக்கொண்டு மீண்டும் இந்தியா வந்த பிறகு அதை எடுத்துக்கொண்டு பல ஊர்களுக்குச் சென்று படங்கள் எடுத்தேன். படங்கள் சுமாராக வந்தபோது கலர் லேப் சரியில்லை, பிலிம் டூபிளிகேட் என்றேன். நன்றாக வந்தபோது எடுத்த விதம் அப்படி என்றேன்.

எழுத்தாளர் சுஜாதாவின் ஸ்ரீரங்கத்துக் கதைகளுக்குப் படம் வரைய திட்டமிட்டபோது ஸ்ரீரங்கம் கோபுரங்களையும், தெருக்களையும் இந்த கேமராதான் கவர்ந்தது. எல்லாவற்றையும் பிரிண்ட் போட்டுப் பார்த்தபோது ‘அட வெயில் இன்னும் கொஞ்சம் இருந்தா நல்லா இருக்குமே’ என்று மீண்டும் மீண்டும் ஸ்ரீரங்கம் சென்று மேலும் மேலும் பல படங்களை எடுத்தேன்.

பானரோமிக் ஷாட் போன்றவை இந்த கேமராவில் இல்லை. அதனால் ஒரு சாக்பீஸில் சாலையில் கோடு போட்டு அந்தக் கோட்டில் நின்றுகொண்டு வரிசையாக மூன்று நான்கு படங்கள் எடுத்து அதை ஒன்றாகத் தைத்தேன்.

அப்போது ஸ்ரீரங்கத்துக் கதைகளில் வரும் ரங்கு கடையைப் படம்பிடித்தபோது, கடைக்கு உள்ளே இருந்தவர் என்னிடம், “உங்களைச் சுஜாதாதானே அனுப்பினார்?” என்று கேட்டார்.

“எப்படிக் கண்டுபிடிச்சீங்க?”

“இந்தக் கடையை மெனக்கெட்டு வேற யார் சார் படம் எடுக்கப் போறாங்க?” என்றார்.

டிஜிட்டல் கேமரா கொஞ்சம் விலை குறைவான பிறகு அதற்குத் தாவினேன். ஃபிலிம் இல்லாமல், எடுத்த படம் உடனேயே தெரிய அதன் வசீகரம் எல்லோரையும் போல என்னையும் கவர்ந்தது. எடுத்துவிட்டு, தேவையில்லை என்றால் அழிக்கலாம், திரும்ப எடுக்கலாம், ஒரு நொடியில் பட பட என்று பத்து படங்களை க்ளிக்கலாம், கம்யூட்டரில் ஏற்றி கலர் மாற்றலாம் என்று எல்லா ஜாலங்களையும் செய்ய முடிந்தது.

சுஜாதாவுடன் அவர் தம்பியையும் இந்த கேமராவில் படம் எடுத்தேன். ஒரு காப்பி வேண்டும் என்றார். அனுப்பினேன். எனக்கு அவர் அனுப்பிய பெரிய கடிதத்தில் நடுவே “delightful” “relive that moment” என்ற வார்த்தைகள் மறக்கமுடியாதவை.

சுஜாதாவுடன் ஸ்ரீரங்கம் சென்றபோது, மேட்டு அழகியசிங்கர் சன்னதிக்கு அவரால் ஏற முடியாதபோது மேலே சென்று அங்கே இருக்கும் சுவர்ச் சித்திரங்களைப் படம் எடுத்து அவருக்குக் காண்பித்தேன். அதைப் பார்த்துவிட்டு சந்தோஷமாக விகடனிலும் எழுதினார்.

சமீபத்தில் நிலவைக் கையில் பிடிக்க நிக்கான் கேமராவை வாங்கினேன். படம் எடுத்தபோது நிலவில் இருக்கும் ஓட்டைகளும், பள்ளங்களும் தெரிந்தன. அது கேமராவா அல்லது டெலஸ்கோப்பா என்று சந்தேகமாக இருக்கிறது.

இன்று எல்லோர் கையிலும் பல ‘மெகா பிக்சல்’ கேமரா, மொபைல் ரூபத்தில் வந்துவிட்டது. பார்த்தவற்றை எல்லாம் எடுத்துக்கொண்டு இருக்கிறோம். பெருமாள் புறப்பாட்டில் பெருமாளுக்கு முன்னாடி திவ்யப்பிரபந்தமும், அதற்கு முன்பாக மொபைல் கேமரா இல்லாமல் இன்று புறப்பாடு இல்லை.

பல ஆயிரம் மைல்களுக்கு அப்பால் எடுத்ததை லைவாகப் பார்க்க முடிகிறது. எந்த நிகழ்வாக இருந்தாலும் நான் நீ என்று டிவிட்டரிலும், முகநூலிலும் திகட்ட திகட்டப் போட்டுவிடுகிறார்கள். நம்மை நாமே செல்ஃபி எடுத்துக்கொள்ளலாம். பல படங்களை எடுத்தாலும் அன்று நானே எடுத்துக் கலவையில் கழுவியபோது தெரிந்த படம்தான் இன்னும் நினைவில் இருக்கிறது.